ID: 1132306384

View in Genome Browser
Species Human (GRCh38)
Location 15:100817184-100817206
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132306382_1132306384 -7 Left 1132306382 15:100817168-100817190 CCTACATGTAAAACATAAAACTA No data
Right 1132306384 15:100817184-100817206 AAAACTAGCCTGTTAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132306384 Original CRISPR AAAACTAGCCTGTTAGGAAC TGG Intergenic
No off target data available for this crispr