ID: 1132309068

View in Genome Browser
Species Human (GRCh38)
Location 15:100843206-100843228
Sequence CAAATCCAACCCTGGCGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132309068_1132309073 0 Left 1132309068 15:100843206-100843228 CCACAGCGCCAGGGTTGGATTTG No data
Right 1132309073 15:100843229-100843251 GTGCTAGAGTTTCTGCTGAGGGG No data
1132309068_1132309072 -1 Left 1132309068 15:100843206-100843228 CCACAGCGCCAGGGTTGGATTTG No data
Right 1132309072 15:100843228-100843250 GGTGCTAGAGTTTCTGCTGAGGG No data
1132309068_1132309074 14 Left 1132309068 15:100843206-100843228 CCACAGCGCCAGGGTTGGATTTG No data
Right 1132309074 15:100843243-100843265 GCTGAGGGGATTGTTATCCTCGG No data
1132309068_1132309075 17 Left 1132309068 15:100843206-100843228 CCACAGCGCCAGGGTTGGATTTG No data
Right 1132309075 15:100843246-100843268 GAGGGGATTGTTATCCTCGGAGG No data
1132309068_1132309071 -2 Left 1132309068 15:100843206-100843228 CCACAGCGCCAGGGTTGGATTTG No data
Right 1132309071 15:100843227-100843249 TGGTGCTAGAGTTTCTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132309068 Original CRISPR CAAATCCAACCCTGGCGCTG TGG (reversed) Intergenic
No off target data available for this crispr