ID: 1132309874

View in Genome Browser
Species Human (GRCh38)
Location 15:100849701-100849723
Sequence GCTCCACACAGGCCACCGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132309867_1132309874 9 Left 1132309867 15:100849669-100849691 CCCCTGGACGTACAGAACCAGCA 0: 1
1: 0
2: 1
3: 4
4: 72
Right 1132309874 15:100849701-100849723 GCTCCACACAGGCCACCGAACGG 0: 1
1: 0
2: 0
3: 10
4: 154
1132309869_1132309874 7 Left 1132309869 15:100849671-100849693 CCTGGACGTACAGAACCAGCAGG 0: 1
1: 0
2: 2
3: 9
4: 117
Right 1132309874 15:100849701-100849723 GCTCCACACAGGCCACCGAACGG 0: 1
1: 0
2: 0
3: 10
4: 154
1132309865_1132309874 11 Left 1132309865 15:100849667-100849689 CCCCCCTGGACGTACAGAACCAG 0: 1
1: 0
2: 5
3: 30
4: 204
Right 1132309874 15:100849701-100849723 GCTCCACACAGGCCACCGAACGG 0: 1
1: 0
2: 0
3: 10
4: 154
1132309868_1132309874 8 Left 1132309868 15:100849670-100849692 CCCTGGACGTACAGAACCAGCAG 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1132309874 15:100849701-100849723 GCTCCACACAGGCCACCGAACGG 0: 1
1: 0
2: 0
3: 10
4: 154
1132309872_1132309874 -8 Left 1132309872 15:100849686-100849708 CCAGCAGGTGGCATCGCTCCACA 0: 1
1: 0
2: 1
3: 6
4: 154
Right 1132309874 15:100849701-100849723 GCTCCACACAGGCCACCGAACGG 0: 1
1: 0
2: 0
3: 10
4: 154
1132309866_1132309874 10 Left 1132309866 15:100849668-100849690 CCCCCTGGACGTACAGAACCAGC 0: 1
1: 0
2: 0
3: 11
4: 87
Right 1132309874 15:100849701-100849723 GCTCCACACAGGCCACCGAACGG 0: 1
1: 0
2: 0
3: 10
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132309874 Original CRISPR GCTCCACACAGGCCACCGAA CGG Intergenic
903440701 1:23385924-23385946 GGCCCACACAGGCCACAGATGGG - Intronic
906645259 1:47470154-47470176 CCTCCCCACAGCCCACAGAAAGG - Intergenic
907049642 1:51321547-51321569 GCTGCACACAGGCCGTGGAATGG + Intronic
907892198 1:58647024-58647046 GCTCCTAACAGGCCACGGACTGG + Intergenic
915216937 1:154346625-154346647 GCTCGACACAGGCTACTGGACGG + Exonic
915685661 1:157630144-157630166 GCTCCTCCCAGCCCACCAAAGGG - Intergenic
916493989 1:165328218-165328240 CCTCAACACAGGTCACAGAACGG - Intronic
919996605 1:202757265-202757287 GTTCCTAACAGGCCACCGACTGG + Intronic
922324419 1:224514904-224514926 GCTCCACACAGGCAAAATAAAGG - Intronic
923141216 1:231162663-231162685 GCTCCTCGCAGGCCACCGCGAGG + Intronic
923505720 1:234604874-234604896 CGTCCACAAAGGCCACCCAAAGG + Exonic
924072723 1:240298504-240298526 GTTCCTAACAGGCCACAGAATGG - Intronic
924770386 1:247074829-247074851 GATCCTAACAGGCCACCGACAGG + Intronic
1064473446 10:15661077-15661099 GCTCCCAACAGGCCACAGACAGG - Intronic
1065611368 10:27474408-27474430 GCTCCATAGAGGCCTCCCAAAGG + Intergenic
1067752492 10:48981356-48981378 GCTCCACACAGGCCACAAGTGGG + Exonic
1068250040 10:54426514-54426536 GTTCCTAACAGGCCACGGAACGG + Intronic
1069861643 10:71475390-71475412 GCTGCACACAGGAAACAGAAAGG - Intronic
1074495894 10:113979816-113979838 GGGCCTCACAGGCCACCGTAAGG + Intergenic
1074994735 10:118746924-118746946 GTTCCTTACAGGCCACCGACCGG - Intronic
1076132220 10:128021300-128021322 GTGCCACACAGGCCTCTGAAGGG + Intronic
1076173200 10:128340494-128340516 GCTTCACAAAGGCCACTGAGAGG + Intergenic
1076201370 10:128561271-128561293 GCTCCTAACAGGCCACTGACTGG + Intergenic
1076621200 10:131789221-131789243 GCTCCTAACAGGCCACAGACTGG - Intergenic
1076692244 10:132229835-132229857 GATCCACCCAGGCCACCGCTTGG - Intronic
1077120332 11:904543-904565 GAGCCACACAGGCCACCCACCGG + Intronic
1077158256 11:1101101-1101123 TCCCCACAGAGGCCACCCAAGGG - Intergenic
1078734518 11:14007741-14007763 GCTCCTAACAGGCCACAGACTGG + Intronic
1081527594 11:43937129-43937151 GCTCCTGACAGGCCAGCCAAGGG - Intronic
1081552531 11:44127316-44127338 GCTCCAAACAGGCCACAGCCCGG - Intronic
1082000914 11:47393362-47393384 CCTGGACACAGGCCACAGAAGGG - Intergenic
1083053251 11:59795637-59795659 GCTCCACAAAGCCCACTGACTGG - Intronic
1085321201 11:75575068-75575090 GCTCCACACAGGGCAGTGATGGG - Intergenic
1087075690 11:94125499-94125521 GCTACACACAGAGCACCGATTGG - Intergenic
1089302481 11:117507028-117507050 GCTCCAGACAGGCCATCCAGGGG - Intronic
1089398004 11:118148395-118148417 GGTCCACAAAGGCCGCCGGAGGG + Intronic
1091218155 11:133916190-133916212 CCTCCCCACAGTCCACAGAAAGG + Intronic
1091630385 12:2155491-2155513 GTTCCACAAAGGCCAAAGAATGG - Intronic
1096370163 12:51062896-51062918 GCTCCACATAGGCCTCCTATGGG + Exonic
1097810710 12:64015721-64015743 GCACCACACAGGACACCGAGGGG + Intronic
1098520044 12:71425117-71425139 GGTACACACAGGGCACAGAATGG - Intronic
1099195293 12:79608522-79608544 GCTCCTAACAGGCCACAGACAGG + Intronic
1099703988 12:86127114-86127136 GTTCCAAACAGGCCACTGATGGG + Intronic
1101964203 12:109271221-109271243 CATCCACACAGGCCACAGAAAGG + Intergenic
1103123414 12:118399859-118399881 GCTCCACACATCCCTCTGAATGG - Intronic
1104538479 12:129640716-129640738 GCTCCTAACAGGCCACAGACTGG - Intronic
1104677210 12:130719531-130719553 ACTGCACACAGGCCACACAAAGG + Intergenic
1104962940 12:132496837-132496859 GCGCAACACAGGACACCGCAGGG - Intronic
1105459152 13:20567308-20567330 GCGCCACACAGGACGCCGCAGGG - Intronic
1106086082 13:26543062-26543084 CTTCCACACAGGACACTGAAAGG - Intergenic
1107515772 13:41127443-41127465 GTTCCAAACAGGCCACAGACTGG + Intergenic
1107609620 13:42100028-42100050 GTTCCTCACAGGCCACGGACTGG - Intronic
1111688715 13:91533664-91533686 GATTAGCACAGGCCACCGAAAGG + Intronic
1112449803 13:99498491-99498513 CCTCCACGCAGGCCACAAAATGG - Intergenic
1113737432 13:112689063-112689085 GCTCTCCACAGGCCACCAAAAGG + Intergenic
1114274087 14:21125989-21126011 GTTCCTAACAGGCCACCGACTGG - Intergenic
1114373289 14:22113646-22113668 GTTCCTAACAGGCCACAGAATGG + Intergenic
1115739864 14:36376780-36376802 GTTCCTAACAGGCCACTGAATGG + Intergenic
1118142089 14:63095077-63095099 GCTCCTAACAGGCCACAGACTGG + Intronic
1118220699 14:63852892-63852914 GCTCTACACTGGCCGCCGAGGGG + Intergenic
1202894242 14_KI270722v1_random:188910-188932 GTTCCTCACAGGCCACAGACTGG - Intergenic
1125750204 15:42022768-42022790 GTTCCAAACAGGCCACGGACTGG + Intronic
1131565687 15:93483431-93483453 GTTCCAAACAGGCCACGGACTGG - Intergenic
1132033359 15:98457536-98457558 GCTCCTAACAGGCCACAGACTGG + Intronic
1132309874 15:100849701-100849723 GCTCCACACAGGCCACCGAACGG + Intergenic
1132535365 16:476553-476575 GGTCCACACTGGCCAGGGAAGGG + Intronic
1135852730 16:25979311-25979333 GCTCCTAACAGGCCATGGAATGG - Intronic
1135920918 16:26648219-26648241 GGTCCACTCAGCCCACTGAACGG + Intergenic
1136610338 16:31362082-31362104 GCTCCCCACAGCCCCCAGAACGG - Exonic
1137972566 16:53000642-53000664 GCTACACACATGGCACCTAAAGG + Intergenic
1138338691 16:56272949-56272971 GCACCACTCAGGTCACCCAAAGG + Intronic
1142274663 16:89111490-89111512 GTTCCACACGGAGCACCGAAGGG - Intronic
1143877693 17:10004507-10004529 GCTCCACACAAGCCCCAGAATGG + Intronic
1149011316 17:51859555-51859577 GTTTCACACAGGCCACTGAAGGG + Intronic
1154005747 18:10526170-10526192 TCTACACACAGGCCCCCGGAAGG - Intronic
1156459355 18:37312991-37313013 GTCCCACAGAGGCCTCCGAAAGG - Intronic
1156479571 18:37427514-37427536 GGTCCCCAGAGGCCACGGAAAGG - Intronic
1157922539 18:51728059-51728081 GCTCCAGGCAGGACACAGAAGGG - Intergenic
1160445929 18:78926651-78926673 GCTCCCCTCAGGCTACCAAAGGG - Intergenic
1164675055 19:30095295-30095317 TGGCCACACAGGCCACAGAATGG + Intergenic
1165212714 19:34248609-34248631 GCACCACAAAGGCCACCAAAAGG + Intergenic
1168178968 19:54646584-54646606 GCACACCACAGGCCACCGACTGG - Intronic
1168348860 19:55664376-55664398 GCTTCTCACAGGCCACAGAATGG + Intronic
932272002 2:70419108-70419130 TCTTCACACAGGCCCCCTAAGGG - Intergenic
933224166 2:79726357-79726379 GCTCCTAACAGGCCACGGACAGG - Intronic
934983993 2:98870724-98870746 GCTCAACCCGGCCCACCGAATGG - Intronic
941923389 2:170873379-170873401 GCTCCACAGACGCCACCTAGTGG + Intergenic
942944800 2:181660290-181660312 GTTCCAAACAGGCCACAGACAGG + Intronic
947820362 2:233064704-233064726 GCCCCACACAGGCCACCTTATGG - Intronic
1170810942 20:19674055-19674077 GGTCTACACAGACCACCGGATGG - Intronic
1172239086 20:33400208-33400230 GTTCCTCACAGGCCACAGACAGG + Intronic
1172331385 20:34078283-34078305 ACCCCACACAGGCCAGTGAAGGG - Intronic
1173833510 20:46109161-46109183 GCTCCTAACAGGCCACGGACTGG - Intergenic
1175986050 20:62764629-62764651 GCACAACACAGGCCCCCCAAGGG - Intergenic
1178319723 21:31596157-31596179 GTTCCTAACAGGCCACAGAACGG - Intergenic
1182426449 22:30275727-30275749 TCTCAACCCAGGCCACAGAAGGG + Intergenic
1184883472 22:47327255-47327277 GCTCCTAACAGGCCACGGACTGG + Intergenic
1185179293 22:49349971-49349993 GCTCCTCACAGGCCTGTGAAGGG - Intergenic
951543732 3:23806365-23806387 GCCCCCCACTGGCCACCGAGGGG + Intronic
951551782 3:23882331-23882353 GCTCCACACAGAGCACTGATTGG + Intronic
956298272 3:67738450-67738472 GCTCCTAACAGGCCACGGATTGG + Intergenic
959033663 3:101334133-101334155 GCTCCTAACAGGCCACAGACTGG + Intronic
961077303 3:123993792-123993814 CCTCCACAGAGGCCTCAGAAAGG - Intergenic
962848380 3:139289966-139289988 GCTCCACACAGGGGGCCCAAAGG - Intronic
963147343 3:142007948-142007970 GCTCCTAACAGGCCACGGACTGG + Intronic
966182332 3:177197932-177197954 GCTCCACCCCGGCCACCGCGCGG - Intergenic
966623042 3:181986339-181986361 GCTCCACAGAAGCCTCAGAAAGG - Intergenic
967972693 3:195011139-195011161 GGTCCACACAAGTCACCGCATGG - Intergenic
969183930 4:5461714-5461736 GCTCCAGACAGGCTATGGAATGG + Intronic
971564556 4:28120754-28120776 GCTCCTAACAGGCCACAGACTGG + Intergenic
973968969 4:56191702-56191724 GTTCCACACAGGTCTCAGAATGG - Intronic
975859621 4:78662945-78662967 GCTCCAGAAAGGCATCCGAATGG + Intergenic
984376826 4:178942132-178942154 GTTCCTCACAGGCCACCAACCGG - Intergenic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
985571147 5:646019-646041 TGTCCACACAGGCCGCCGATGGG - Intronic
987076742 5:14389885-14389907 TCTCATCACAGGCCACCTAAAGG - Intronic
990383165 5:55234677-55234699 GATTCACTCAGGCCACAGAAGGG - Intergenic
992618683 5:78571222-78571244 GGTCCACACAGGCCAAAAAAAGG - Intronic
997905129 5:137808783-137808805 TCTCCACACAGGCCACCTGGTGG - Intergenic
1000908149 5:166988707-166988729 GCTCCAGCCAGGCCACTGATAGG - Intergenic
1005283317 6:24298283-24298305 GTTCCTAACAGGCCACGGAATGG + Intronic
1008596188 6:53044161-53044183 GCTCCTAACAGGCCACAGACTGG - Intronic
1008955662 6:57213266-57213288 GTTCCTAACAGGCCACAGAACGG + Intronic
1012973391 6:105754914-105754936 GTTCCTAACAGGCCACAGAATGG - Intergenic
1014203593 6:118630750-118630772 GCTCCCAACAGGCCACTGACCGG - Intronic
1018289970 6:162282094-162282116 GGTCCTCACAGGCCACAGACAGG + Intronic
1019733532 7:2639754-2639776 GCTCCACAGAGGCCACTGAGGGG - Intronic
1021177285 7:17463608-17463630 GCTCCTAACAGGCCACGGACAGG - Intergenic
1021256807 7:18402317-18402339 GCTCAACAAAGGCCTCCTAAAGG + Intronic
1021554361 7:21904445-21904467 GTTCCAAACAGGCCACAGACTGG - Intronic
1022734002 7:33059141-33059163 GCTCCACACTGGCCATTGAGAGG + Intronic
1023187628 7:37548560-37548582 GTTCCTAATAGGCCACCGAATGG - Intergenic
1023517705 7:41018260-41018282 GCTCCAGAAAGGCCACCAAAGGG + Intergenic
1024005177 7:45219965-45219987 GCTCCACAAAGGCCAACGTGTGG - Intergenic
1025077282 7:55953951-55953973 GTTCCTAACAGGCCACTGAATGG + Intronic
1027267873 7:76504047-76504069 GCTCAAGACAGGAGACCGAAAGG - Intronic
1027319684 7:77003909-77003931 GCTCAAGACAGGAGACCGAAAGG - Intergenic
1032723037 7:134566332-134566354 GCTTCACCCAGGCTACCTAACGG + Intronic
1034267515 7:149788415-149788437 CCTCCACACAGGCCACCACCTGG - Intergenic
1034685345 7:152966306-152966328 GTTCCAAACAGGCCACAGAGTGG + Intergenic
1034842748 7:154414792-154414814 GCCCCACACAGGTTGCCGAAGGG + Intronic
1038575960 8:28703097-28703119 GCTCCCCACAAGCAAACGAATGG - Intronic
1043395073 8:79827806-79827828 GCCCCATTCAGGCCACCGAGTGG - Intergenic
1043979164 8:86618255-86618277 GTTCCCAACAGGCCACCGACTGG + Intronic
1045283746 8:100772342-100772364 GTTCCTAACAGGCCACAGAAGGG + Intergenic
1045885949 8:107097978-107098000 GTTCCTAACAGGCCACAGAATGG + Intergenic
1047478632 8:125259294-125259316 GTTCCTAACAGGCCACCGACTGG - Intronic
1048497734 8:134949069-134949091 GCGGCACACAAGCCACTGAATGG + Intergenic
1050131272 9:2415207-2415229 GCTCCTAACAGGCCACCAACAGG + Intergenic
1052840658 9:33289225-33289247 GCTCCAGCCAGACCCCCGAAAGG + Intergenic
1057803776 9:98206419-98206441 GCAGCACACAGGCCACAGAGAGG - Intronic
1059151734 9:111955290-111955312 GCTCCTAACAGGCCACAGACGGG + Intergenic
1059347999 9:113645343-113645365 GCTCCTAACAGGCCACAGACTGG - Intergenic
1059470675 9:114503106-114503128 CCTGGACACAGGCCACTGAACGG + Intronic
1061965227 9:134010023-134010045 GCTCCAGACAGTTCACAGAAAGG + Intergenic
1062374699 9:136256661-136256683 GCCCCACACAGCCCACAGGAAGG + Intergenic
1185837445 X:3358258-3358280 GTTCCCAACAGGCCACCGACTGG - Intergenic
1187014108 X:15308846-15308868 GTTCCTAACAGGCCACGGAATGG - Intronic
1188692645 X:33149464-33149486 GTTCCTCACAGGCCACAGATGGG + Intronic
1189483881 X:41414260-41414282 GCTCCTAACAGGCCACAGACTGG - Intergenic
1190299630 X:49049451-49049473 GCTCCTAACAGGCCACTGACTGG + Intergenic
1192102263 X:68277370-68277392 GCTCCTAACAGGCCACAGACTGG + Intronic
1192548661 X:72035856-72035878 GTTCCAAACAGGCCACAGACTGG - Intergenic
1200928569 Y:8676372-8676394 GACCCACACAGGCCACAAAAGGG + Intergenic
1200936605 Y:8743812-8743834 GAGCCACACAAGCCACCTAAAGG + Intergenic