ID: 1132309920

View in Genome Browser
Species Human (GRCh38)
Location 15:100849889-100849911
Sequence AAACCTGGTCTCCCGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132309913_1132309920 20 Left 1132309913 15:100849846-100849868 CCTCTCACGGCAGCTATGAGACT 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1132309920 15:100849889-100849911 AAACCTGGTCTCCCGGAGCCAGG 0: 1
1: 1
2: 1
3: 7
4: 129
1132309912_1132309920 21 Left 1132309912 15:100849845-100849867 CCCTCTCACGGCAGCTATGAGAC 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1132309920 15:100849889-100849911 AAACCTGGTCTCCCGGAGCCAGG 0: 1
1: 1
2: 1
3: 7
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132309920 Original CRISPR AAACCTGGTCTCCCGGAGCC AGG Intergenic
900481903 1:2903461-2903483 AAGCCTGGTTTCCCAGACCCAGG + Intergenic
901209711 1:7517915-7517937 AACCCTGGGCTCTCAGAGCCAGG - Intronic
903263172 1:22142282-22142304 ACGCCTGGTCTCCCAGGGCCCGG - Intronic
903646246 1:24897894-24897916 AACCCTGGCCTCCTGGACCCTGG - Intergenic
905345133 1:37306123-37306145 AGGCCTGTTCTCCAGGAGCCAGG + Intergenic
905632224 1:39525184-39525206 AGGCCTGGCCTCCCAGAGCCTGG + Intronic
905789957 1:40784448-40784470 AAGCCTGGCCTCCCGGGGCACGG + Intronic
906242538 1:44250877-44250899 AAAACTGCTCTCCCTCAGCCTGG + Intronic
906285984 1:44588198-44588220 AATCCTGATCTCTGGGAGCCGGG + Intronic
907659652 1:56380194-56380216 AGAGGTGGTCTCCCTGAGCCAGG + Intergenic
921060238 1:211578922-211578944 GGAGCTGGGCTCCCGGAGCCGGG + Intergenic
922542968 1:226433118-226433140 AACACTGGGGTCCCGGAGCCTGG + Intergenic
922686895 1:227646654-227646676 AAACCTGGTCTCCCTGGGTGAGG + Exonic
924785967 1:247200061-247200083 AAACCTGGTCTCCCTGGGTGAGG - Intergenic
1066349899 10:34627624-34627646 ACACCTGGGCTTCCGAAGCCAGG + Intronic
1070469031 10:76759181-76759203 AAATCTGGTCTCCCTGAGCAAGG + Intergenic
1073452759 10:103619350-103619372 AATCCTGGATTCCCGGAGCCTGG - Intronic
1075849245 10:125573989-125574011 AAACCGGGTCTCCCTGAGCGAGG + Intergenic
1077362093 11:2145329-2145351 AAACCTGGTCCCCGGGAGAGCGG + Intronic
1079023342 11:16926035-16926057 AACCCGGGTCTCCTGCAGCCTGG - Intronic
1079472226 11:20789487-20789509 AGACCTGGGCTCCCCGAGCCAGG - Intronic
1079985705 11:27198311-27198333 AATACTGGTCTCCCTGAGCTTGG + Intergenic
1080393820 11:31871895-31871917 CAGCCTGGTCTTCCGGAGGCGGG - Intronic
1084966285 11:72746348-72746370 ACAGCTGGTCTCCAGGTGCCGGG - Intronic
1089631487 11:119787248-119787270 GCACCTGGTCCCCAGGAGCCAGG + Intergenic
1091717928 12:2793301-2793323 CATCCTGGTCTCCCGGAGTTTGG + Intergenic
1101521394 12:105485528-105485550 AAAGCTGGGCTCCCTGACCCTGG - Intergenic
1102659398 12:114512816-114512838 AAACCAGGTCTCCAGGCACCAGG - Intergenic
1103440125 12:120956871-120956893 AGAGCTGGTCACCAGGAGCCAGG + Intergenic
1112602208 13:100868220-100868242 ATACCTGGCCTCACAGAGCCTGG - Intergenic
1114539260 14:23442813-23442835 CAGCCTGGTCTCCCCGTGCCTGG + Intergenic
1115303707 14:31913397-31913419 GTACCTGGTCTCACAGAGCCTGG - Intergenic
1118011702 14:61616409-61616431 CAGCCTGGGCTCCAGGAGCCTGG + Intronic
1121757282 14:96413593-96413615 AAACCACGTCACCTGGAGCCAGG - Intronic
1202921907 14_KI270723v1_random:35060-35082 AATCCTGGACTCCGGGAGGCCGG - Intergenic
1124649376 15:31463634-31463656 GCACCTGGTGTCCGGGAGCCGGG + Intergenic
1126657471 15:50994726-50994748 AAACCAGGGCTCCATGAGCCTGG - Intronic
1129150257 15:73684142-73684164 AACCCTCGGCTCCCGGAGCAGGG - Intronic
1132309920 15:100849889-100849911 AAACCTGGTCTCCCGGAGCCAGG + Intergenic
1132745942 16:1436321-1436343 AGACCTGTTCCCCCTGAGCCCGG - Intronic
1137250602 16:46737877-46737899 CAATGTGGTCTCCCCGAGCCTGG - Exonic
1138652829 16:58471568-58471590 AAACCTGGTCTCACAGAGCCAGG + Intronic
1139442195 16:66973916-66973938 GAAACTGGTCTCCCCAAGCCAGG - Exonic
1141148262 16:81547099-81547121 ATGCCTGGGCTCCCGGAGGCAGG + Intronic
1141538385 16:84699682-84699704 CCACCTGGGCCCCCGGAGCCCGG - Intergenic
1143388742 17:6547669-6547691 CAACCTGGCCTCCCGTTGCCTGG - Intronic
1143884337 17:10054836-10054858 AGAACTGGGCTCCCTGAGCCTGG + Intronic
1144168899 17:12639378-12639400 AACCTTGGTCTACCTGAGCCTGG - Intergenic
1145017264 17:19407585-19407607 ACACCTGGCCTCCCTGGGCCAGG + Intergenic
1148969921 17:51470763-51470785 AACCCAGATCTCCCAGAGCCAGG - Intergenic
1151180324 17:72322717-72322739 AAGCATGGTCTTCCAGAGCCTGG + Intergenic
1152065200 17:78108583-78108605 CAACCTGGTCTCCCAGGCCCAGG - Exonic
1152801265 17:82331795-82331817 GTACCTGGTCTCCCTGTGCCAGG - Intronic
1153490886 18:5646721-5646743 AAACTTGTTCTCCAGGGGCCAGG + Intergenic
1158859898 18:61581977-61581999 AAACCCAGCCTCCCGGTGCCCGG + Intergenic
1162646577 19:12054341-12054363 AGACCTGGTCTCACTGCGCCCGG - Intergenic
1163236647 19:16033982-16034004 GAACCTGGTCTTCAGGGGCCTGG + Intergenic
1163236701 19:16034185-16034207 AAACCTGGTCATCGGGGGCCTGG + Intergenic
1163863217 19:19753236-19753258 GAACCTGGTTTCCAGGAGCTTGG - Intergenic
1167693746 19:51002269-51002291 AAACCTGCCCTCCCAGATCCCGG - Intronic
926153809 2:10439510-10439532 AACTCTGGTCTCCCTGGGCCAGG - Intergenic
927252469 2:21009241-21009263 AAACCTGGCCTACCAGAGACAGG + Exonic
927651647 2:24917154-24917176 GCACCTGGTCTCCAGGACCCAGG + Intronic
933730884 2:85455511-85455533 AAAGCTGGTCACCCCCAGCCTGG - Intergenic
938759478 2:134411277-134411299 AAACATGGTAGCCAGGAGCCTGG - Intronic
940169740 2:150815645-150815667 AATCATGTTCTCCAGGAGCCAGG + Intergenic
942105324 2:172628324-172628346 ATATCTGGTCTCACGGTGCCGGG + Intergenic
945591940 2:211744621-211744643 GAACTTGTTCTCCCAGAGCCTGG + Intronic
946564105 2:220944136-220944158 AATCCTGGTGTCCTGGATCCAGG + Intergenic
947981135 2:234410624-234410646 AATCCTGGTCTCCTGGACCCTGG + Intergenic
948509044 2:238450886-238450908 AGGCCTGGCCTCCCGGGGCCTGG + Exonic
1169849640 20:10035190-10035212 GACCTTGGGCTCCCGGAGCCCGG - Exonic
1174192956 20:48753317-48753339 GAACCAGGTCTCCCGATGCCAGG + Intronic
1175922947 20:62458595-62458617 AGACCTGCTCTCCCTGATCCCGG - Intergenic
1179018288 21:37614165-37614187 AAACCTGGTCTTCTGAATCCAGG + Exonic
1180228317 21:46411623-46411645 AGACATGGCCTCCCGGATCCAGG + Exonic
1180923403 22:19534884-19534906 AAACCTTATCTCCCGGTGGCCGG - Intergenic
1181090344 22:20468228-20468250 AAACTTGGTCTTCAGGACCCTGG - Intronic
1181769053 22:25112354-25112376 ACACCTGGCTTCCCGGAGTCGGG + Intronic
1182450731 22:30419154-30419176 AAACCAGGCCTCCTGGTGCCTGG - Intronic
1184091671 22:42296205-42296227 CAGCCTGGCCTCCCCGAGCCAGG + Intronic
1184715644 22:46280310-46280332 AAGCCAGGGCTCCAGGAGCCAGG + Intronic
1185221732 22:49632436-49632458 GATCCTGCTCTCCCGGAGCGAGG + Intronic
950502523 3:13373342-13373364 TGGCCTGGTCTCTCGGAGCCTGG + Intronic
952367189 3:32685335-32685357 GAACCTGGGGGCCCGGAGCCGGG + Intronic
953194013 3:40714969-40714991 CAAACTGGTCTACCTGAGCCTGG - Intergenic
955023885 3:55148398-55148420 AAGCCAGGCATCCCGGAGCCTGG + Intergenic
955716620 3:61836456-61836478 AAAGCTGGCCTCCAGGAGACAGG - Intronic
964177718 3:153845094-153845116 AAAGCTCTTCTCACGGAGCCAGG - Intergenic
964315057 3:155434750-155434772 AAGCCTTGTCTCCCTGAGGCAGG + Intronic
965773884 3:172209041-172209063 AACTCAGGGCTCCCGGAGCCAGG - Intronic
966712164 3:182981238-182981260 CAACCTGGACTCCCGCAGCCCGG - Intronic
968385289 4:130898-130920 AAACCTGGTCTCCCTGGGTAAGG + Exonic
968394253 4:218762-218784 AAACCTGGTCTCCCTGGGTGAGG + Intergenic
968540932 4:1167996-1168018 AAAGCTGCTCTGCCCGAGCCTGG + Intronic
968828167 4:2914846-2914868 ACATCTGGTCTGCAGGAGCCCGG - Intronic
970194695 4:13542669-13542691 AAGACTGGTCTCCCGGGCCCAGG - Intronic
972458091 4:39273535-39273557 ACACCTGCTCTCTGGGAGCCTGG - Intronic
975369976 4:73573948-73573970 AAGCCTGCTCTCCAGTAGCCTGG - Exonic
984257079 4:177401865-177401887 AAACCTGGTTACTCAGAGCCTGG + Intergenic
984929926 4:184837875-184837897 AAACCTGGTCTCCCCGAGCCTGG - Intergenic
985984454 5:3503262-3503284 AAACCTCGTGTCACGCAGCCTGG - Intergenic
990533667 5:56698813-56698835 AAATCTAGTCTGCCGGAGCAGGG + Intergenic
993161085 5:84292393-84292415 AGACATAGTGTCCCGGAGCCAGG + Intronic
993957096 5:94247538-94247560 CAACCTGGTCTCAGGGAGTCAGG - Intronic
997590900 5:135071606-135071628 AACCCTGGCCTCACTGAGCCAGG + Intronic
998565426 5:143212192-143212214 AAACCTGGTCTCTGAGACCCTGG + Intronic
1003563949 6:7206758-7206780 AAACCTGGACGGCAGGAGCCAGG + Intronic
1006767740 6:36523553-36523575 AAACCTGGTACCCCGGGGCCAGG - Intronic
1006793864 6:36720242-36720264 AAGCTGGGTCTCCAGGAGCCTGG + Intronic
1013465716 6:110415514-110415536 AAACCTTGTTTCCCAGTGCCTGG + Exonic
1013980313 6:116121208-116121230 AAGCCTGGTTTCCCAAAGCCAGG + Exonic
1021995967 7:26178670-26178692 AAAGATGAACTCCCGGAGCCAGG + Intronic
1023869249 7:44254134-44254156 CAATCTGGTCTCCAGCAGCCGGG + Intronic
1025222491 7:57126586-57126608 AAACCTGGTCTCCCTGGGTGAGG - Exonic
1025266442 7:57462570-57462592 AAACCTGGTCTCCCTGGGTGAGG + Exonic
1025720379 7:64005722-64005744 AAACCTGGTCTCCCTGGGTGAGG + Intergenic
1025747853 7:64260331-64260353 AAACCTGGTCTCCCTGGGTGAGG + Exonic
1034495122 7:151416271-151416293 AGCCCTGGTGTCCCTGAGCCAGG + Intergenic
1035292821 7:157850461-157850483 ATCCCAGGTCTCCCGGGGCCTGG + Intronic
1038529735 8:28308538-28308560 GAGCCTGGACTCCTGGAGCCAGG + Intergenic
1040842170 8:51795890-51795912 TAACCTGGTCACCCCGACCCTGG + Intronic
1043548392 8:81340686-81340708 AAACCTGATCTCCCTAAACCAGG - Intergenic
1043581532 8:81721177-81721199 AGCCCTGGTCTCCCGCGGCCGGG + Intronic
1047295579 8:123567859-123567881 AAACCTGCTCTCCAAGAGCTGGG + Intergenic
1048274505 8:133056062-133056084 AAACCAGGTCTCCCTGGGCAGGG + Intronic
1049156070 8:141067612-141067634 AAACCTTGTCCCCAGCAGCCTGG + Intergenic
1053653119 9:40189319-40189341 AACCCTGGCCTCCCTTAGCCTGG + Intergenic
1053903522 9:42818622-42818644 AACCCTGGCCTCCCTTAGCCTGG + Intergenic
1054531465 9:66186904-66186926 AACCCTGGCCTCCCTTAGCCTGG - Intergenic
1054777966 9:69139756-69139778 AGACCAGGTCTCCCATAGCCAGG + Intronic
1060151249 9:121289729-121289751 GACCTTGGTCTCCCGGAGGCAGG + Intronic
1060471883 9:123954866-123954888 AGACCTCTTCTCCCTGAGCCCGG - Intergenic
1061257409 9:129460650-129460672 AAAACTGAACCCCCGGAGCCGGG - Intergenic
1062379806 9:136281754-136281776 GAACCTGGGCTCCCGTGGCCTGG + Intronic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic
1188002605 X:24996210-24996232 AAACCGGGTCTTCAGGAGCTTGG - Exonic
1197595414 X:128458158-128458180 ATGCCTGGTATCCCGGAGACAGG - Intergenic
1200122487 X:153797718-153797740 AACCCAGGTGTCCTGGAGCCTGG + Exonic