ID: 1132311088 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:100858529-100858551 |
Sequence | CTCAGGGGGCTGCATGTAAG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1132311088_1132311092 | -10 | Left | 1132311088 | 15:100858529-100858551 | CCACTTACATGCAGCCCCCTGAG | No data | ||
Right | 1132311092 | 15:100858542-100858564 | GCCCCCTGAGGGTCCCAGAAGGG | No data | ||||
1132311088_1132311100 | 18 | Left | 1132311088 | 15:100858529-100858551 | CCACTTACATGCAGCCCCCTGAG | No data | ||
Right | 1132311100 | 15:100858570-100858592 | TCAGTCACTGAGCTCTCACTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1132311088 | Original CRISPR | CTCAGGGGGCTGCATGTAAG TGG (reversed) | Intergenic | ||