ID: 1132311095

View in Genome Browser
Species Human (GRCh38)
Location 15:100858545-100858567
Sequence GCTCCCTTCTGGGACCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132311095_1132311102 20 Left 1132311095 15:100858545-100858567 CCCTGAGGGTCCCAGAAGGGAGC No data
Right 1132311102 15:100858588-100858610 CTAGGCCAGAATTCCAGGAAAGG No data
1132311095_1132311101 15 Left 1132311095 15:100858545-100858567 CCCTGAGGGTCCCAGAAGGGAGC No data
Right 1132311101 15:100858583-100858605 TCTCACTAGGCCAGAATTCCAGG No data
1132311095_1132311100 2 Left 1132311095 15:100858545-100858567 CCCTGAGGGTCCCAGAAGGGAGC No data
Right 1132311100 15:100858570-100858592 TCAGTCACTGAGCTCTCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132311095 Original CRISPR GCTCCCTTCTGGGACCCTCA GGG (reversed) Intergenic
No off target data available for this crispr