ID: 1132311096

View in Genome Browser
Species Human (GRCh38)
Location 15:100858546-100858568
Sequence GGCTCCCTTCTGGGACCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132311096_1132311102 19 Left 1132311096 15:100858546-100858568 CCTGAGGGTCCCAGAAGGGAGCC No data
Right 1132311102 15:100858588-100858610 CTAGGCCAGAATTCCAGGAAAGG No data
1132311096_1132311100 1 Left 1132311096 15:100858546-100858568 CCTGAGGGTCCCAGAAGGGAGCC No data
Right 1132311100 15:100858570-100858592 TCAGTCACTGAGCTCTCACTAGG No data
1132311096_1132311101 14 Left 1132311096 15:100858546-100858568 CCTGAGGGTCCCAGAAGGGAGCC No data
Right 1132311101 15:100858583-100858605 TCTCACTAGGCCAGAATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132311096 Original CRISPR GGCTCCCTTCTGGGACCCTC AGG (reversed) Intergenic