ID: 1132311098

View in Genome Browser
Species Human (GRCh38)
Location 15:100858556-100858578
Sequence AGTGACTGAAGGCTCCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132311098_1132311100 -9 Left 1132311098 15:100858556-100858578 CCAGAAGGGAGCCTTCAGTCACT No data
Right 1132311100 15:100858570-100858592 TCAGTCACTGAGCTCTCACTAGG No data
1132311098_1132311102 9 Left 1132311098 15:100858556-100858578 CCAGAAGGGAGCCTTCAGTCACT No data
Right 1132311102 15:100858588-100858610 CTAGGCCAGAATTCCAGGAAAGG No data
1132311098_1132311101 4 Left 1132311098 15:100858556-100858578 CCAGAAGGGAGCCTTCAGTCACT No data
Right 1132311101 15:100858583-100858605 TCTCACTAGGCCAGAATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132311098 Original CRISPR AGTGACTGAAGGCTCCCTTC TGG (reversed) Intergenic