ID: 1132311099

View in Genome Browser
Species Human (GRCh38)
Location 15:100858567-100858589
Sequence AGTGAGAGCTCAGTGACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132311099_1132311102 -2 Left 1132311099 15:100858567-100858589 CCTTCAGTCACTGAGCTCTCACT No data
Right 1132311102 15:100858588-100858610 CTAGGCCAGAATTCCAGGAAAGG No data
1132311099_1132311101 -7 Left 1132311099 15:100858567-100858589 CCTTCAGTCACTGAGCTCTCACT No data
Right 1132311101 15:100858583-100858605 TCTCACTAGGCCAGAATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132311099 Original CRISPR AGTGAGAGCTCAGTGACTGA AGG (reversed) Intergenic
No off target data available for this crispr