ID: 1132311100

View in Genome Browser
Species Human (GRCh38)
Location 15:100858570-100858592
Sequence TCAGTCACTGAGCTCTCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132311097_1132311100 -8 Left 1132311097 15:100858555-100858577 CCCAGAAGGGAGCCTTCAGTCAC No data
Right 1132311100 15:100858570-100858592 TCAGTCACTGAGCTCTCACTAGG No data
1132311083_1132311100 28 Left 1132311083 15:100858519-100858541 CCGGCCCTCCCCACTTACATGCA No data
Right 1132311100 15:100858570-100858592 TCAGTCACTGAGCTCTCACTAGG No data
1132311085_1132311100 23 Left 1132311085 15:100858524-100858546 CCTCCCCACTTACATGCAGCCCC No data
Right 1132311100 15:100858570-100858592 TCAGTCACTGAGCTCTCACTAGG No data
1132311084_1132311100 24 Left 1132311084 15:100858523-100858545 CCCTCCCCACTTACATGCAGCCC No data
Right 1132311100 15:100858570-100858592 TCAGTCACTGAGCTCTCACTAGG No data
1132311087_1132311100 19 Left 1132311087 15:100858528-100858550 CCCACTTACATGCAGCCCCCTGA No data
Right 1132311100 15:100858570-100858592 TCAGTCACTGAGCTCTCACTAGG No data
1132311095_1132311100 2 Left 1132311095 15:100858545-100858567 CCCTGAGGGTCCCAGAAGGGAGC No data
Right 1132311100 15:100858570-100858592 TCAGTCACTGAGCTCTCACTAGG No data
1132311086_1132311100 20 Left 1132311086 15:100858527-100858549 CCCCACTTACATGCAGCCCCCTG No data
Right 1132311100 15:100858570-100858592 TCAGTCACTGAGCTCTCACTAGG No data
1132311096_1132311100 1 Left 1132311096 15:100858546-100858568 CCTGAGGGTCCCAGAAGGGAGCC No data
Right 1132311100 15:100858570-100858592 TCAGTCACTGAGCTCTCACTAGG No data
1132311094_1132311100 3 Left 1132311094 15:100858544-100858566 CCCCTGAGGGTCCCAGAAGGGAG No data
Right 1132311100 15:100858570-100858592 TCAGTCACTGAGCTCTCACTAGG No data
1132311098_1132311100 -9 Left 1132311098 15:100858556-100858578 CCAGAAGGGAGCCTTCAGTCACT No data
Right 1132311100 15:100858570-100858592 TCAGTCACTGAGCTCTCACTAGG No data
1132311088_1132311100 18 Left 1132311088 15:100858529-100858551 CCACTTACATGCAGCCCCCTGAG No data
Right 1132311100 15:100858570-100858592 TCAGTCACTGAGCTCTCACTAGG No data
1132311093_1132311100 4 Left 1132311093 15:100858543-100858565 CCCCCTGAGGGTCCCAGAAGGGA No data
Right 1132311100 15:100858570-100858592 TCAGTCACTGAGCTCTCACTAGG No data
1132311081_1132311100 30 Left 1132311081 15:100858517-100858539 CCCCGGCCCTCCCCACTTACATG No data
Right 1132311100 15:100858570-100858592 TCAGTCACTGAGCTCTCACTAGG No data
1132311082_1132311100 29 Left 1132311082 15:100858518-100858540 CCCGGCCCTCCCCACTTACATGC No data
Right 1132311100 15:100858570-100858592 TCAGTCACTGAGCTCTCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132311100 Original CRISPR TCAGTCACTGAGCTCTCACT AGG Intergenic