ID: 1132311102

View in Genome Browser
Species Human (GRCh38)
Location 15:100858588-100858610
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132311099_1132311102 -2 Left 1132311099 15:100858567-100858589 CCTTCAGTCACTGAGCTCTCACT No data
Right 1132311102 15:100858588-100858610 CTAGGCCAGAATTCCAGGAAAGG No data
1132311094_1132311102 21 Left 1132311094 15:100858544-100858566 CCCCTGAGGGTCCCAGAAGGGAG No data
Right 1132311102 15:100858588-100858610 CTAGGCCAGAATTCCAGGAAAGG No data
1132311097_1132311102 10 Left 1132311097 15:100858555-100858577 CCCAGAAGGGAGCCTTCAGTCAC No data
Right 1132311102 15:100858588-100858610 CTAGGCCAGAATTCCAGGAAAGG No data
1132311095_1132311102 20 Left 1132311095 15:100858545-100858567 CCCTGAGGGTCCCAGAAGGGAGC No data
Right 1132311102 15:100858588-100858610 CTAGGCCAGAATTCCAGGAAAGG No data
1132311096_1132311102 19 Left 1132311096 15:100858546-100858568 CCTGAGGGTCCCAGAAGGGAGCC No data
Right 1132311102 15:100858588-100858610 CTAGGCCAGAATTCCAGGAAAGG No data
1132311093_1132311102 22 Left 1132311093 15:100858543-100858565 CCCCCTGAGGGTCCCAGAAGGGA No data
Right 1132311102 15:100858588-100858610 CTAGGCCAGAATTCCAGGAAAGG No data
1132311098_1132311102 9 Left 1132311098 15:100858556-100858578 CCAGAAGGGAGCCTTCAGTCACT No data
Right 1132311102 15:100858588-100858610 CTAGGCCAGAATTCCAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132311102 Original CRISPR CTAGGCCAGAATTCCAGGAA AGG Intergenic