ID: 1132314457

View in Genome Browser
Species Human (GRCh38)
Location 15:100879910-100879932
Sequence GGCCACCGCTAACGGGGCCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132314451_1132314457 -1 Left 1132314451 15:100879888-100879910 CCAGGGAGCGCGGAGGAGCCATG 0: 1
1: 0
2: 1
3: 15
4: 148
Right 1132314457 15:100879910-100879932 GGCCACCGCTAACGGGGCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 57
1132314442_1132314457 29 Left 1132314442 15:100879858-100879880 CCGGTGCGCCGCAGACTAGGGCG 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1132314457 15:100879910-100879932 GGCCACCGCTAACGGGGCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 57
1132314449_1132314457 6 Left 1132314449 15:100879881-100879903 CCTCGGGCCAGGGAGCGCGGAGG 0: 1
1: 1
2: 2
3: 24
4: 262
Right 1132314457 15:100879910-100879932 GGCCACCGCTAACGGGGCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 57
1132314445_1132314457 21 Left 1132314445 15:100879866-100879888 CCGCAGACTAGGGCGCCTCGGGC 0: 1
1: 0
2: 0
3: 0
4: 54
Right 1132314457 15:100879910-100879932 GGCCACCGCTAACGGGGCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132314457 Original CRISPR GGCCACCGCTAACGGGGCCG TGG Exonic