ID: 1132314780

View in Genome Browser
Species Human (GRCh38)
Location 15:100881640-100881662
Sequence ATGGTTGCCTGTTGTCTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132314777_1132314780 -2 Left 1132314777 15:100881619-100881641 CCTTAGACAATTCACAGAGCAAT 0: 1
1: 0
2: 0
3: 20
4: 196
Right 1132314780 15:100881640-100881662 ATGGTTGCCTGTTGTCTTGGTGG 0: 1
1: 0
2: 0
3: 15
4: 141
1132314776_1132314780 9 Left 1132314776 15:100881608-100881630 CCTTATGGAGACCTTAGACAATT 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1132314780 15:100881640-100881662 ATGGTTGCCTGTTGTCTTGGTGG 0: 1
1: 0
2: 0
3: 15
4: 141
1132314775_1132314780 10 Left 1132314775 15:100881607-100881629 CCCTTATGGAGACCTTAGACAAT 0: 1
1: 0
2: 0
3: 7
4: 141
Right 1132314780 15:100881640-100881662 ATGGTTGCCTGTTGTCTTGGTGG 0: 1
1: 0
2: 0
3: 15
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132314780 Original CRISPR ATGGTTGCCTGTTGTCTTGG TGG Intronic