ID: 1132314803

View in Genome Browser
Species Human (GRCh38)
Location 15:100881759-100881781
Sequence CAGTTGGGGCCTTTATCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132314803_1132314814 13 Left 1132314803 15:100881759-100881781 CCAGGCGATAAAGGCCCCAACTG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1132314814 15:100881795-100881817 GCTGGCTCCTCACCCGTTGGGGG 0: 1
1: 0
2: 1
3: 6
4: 78
1132314803_1132314808 -5 Left 1132314803 15:100881759-100881781 CCAGGCGATAAAGGCCCCAACTG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1132314808 15:100881777-100881799 AACTGCCTGACACCGGCTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 69
1132314803_1132314813 12 Left 1132314803 15:100881759-100881781 CCAGGCGATAAAGGCCCCAACTG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1132314813 15:100881794-100881816 TGCTGGCTCCTCACCCGTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 78
1132314803_1132314812 11 Left 1132314803 15:100881759-100881781 CCAGGCGATAAAGGCCCCAACTG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1132314812 15:100881793-100881815 CTGCTGGCTCCTCACCCGTTGGG 0: 1
1: 0
2: 2
3: 14
4: 112
1132314803_1132314811 10 Left 1132314803 15:100881759-100881781 CCAGGCGATAAAGGCCCCAACTG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1132314811 15:100881792-100881814 GCTGCTGGCTCCTCACCCGTTGG 0: 1
1: 0
2: 0
3: 14
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132314803 Original CRISPR CAGTTGGGGCCTTTATCGCC TGG (reversed) Intronic
900043415 1:489823-489845 GAGTTGGGGCCTTGACAGCCTGG + Intergenic
900064853 1:724820-724842 GAGTTGGGGCCTTGACAGCCTGG + Intergenic
904312131 1:29635702-29635724 CAGGTGGGGCCTTTCTCCTCTGG - Intergenic
910694027 1:89993751-89993773 CAGCTGGGGCCTCTACCGACCGG + Intergenic
919749421 1:201027469-201027491 CAGTTGGTGAGTTTATAGCCTGG + Intergenic
922099758 1:222470838-222470860 GAGTTGGGGCCTTGACAGCCTGG + Intergenic
922261792 1:223950331-223950353 GAGTTGGGGCCTTGACAGCCTGG + Intergenic
922735286 1:227975411-227975433 GAGTTGGGGCCTTGACAGCCTGG - Intergenic
924342958 1:243052506-243052528 GAGTTGGGGCCTTGACAGCCTGG + Intergenic
924537906 1:244953215-244953237 CCGTTGGGGCCTTTCGCCCCTGG - Intergenic
1066733522 10:38453046-38453068 GAGTTGGGGCCTTGACAGCCTGG - Intergenic
1070833948 10:79436416-79436438 GAGTCGGGGCCTCTATGGCCGGG - Intronic
1071598652 10:86945381-86945403 CAGTTGGGGCCCGTGTAGCCAGG + Exonic
1074091953 10:110268738-110268760 CAGTTGGGCCCTTTGTGGTCAGG + Intronic
1076367025 10:129927736-129927758 CAGTTGGGTCCCTTATCCACTGG + Intronic
1076969688 11:126040-126062 GAGTTGGGGCCTTGACAGCCTGG + Intergenic
1091609629 12:1994816-1994838 CAGTTGGCACATTTATCCCCTGG - Intronic
1093539140 12:20260270-20260292 CAGTGGAGGCCTTTATTGCTGGG + Intergenic
1096585727 12:52618371-52618393 CAGTCGGAGCCTTTACAGCCTGG - Exonic
1101100407 12:101385832-101385854 CGGTTGGGGACTTTATAGCTGGG + Intronic
1103738927 12:123078389-123078411 GAGATGGGGGCTTTCTCGCCTGG + Intronic
1104109156 12:125689178-125689200 CGGTTGGGGCCTCCATAGCCTGG + Intergenic
1105653832 13:22411547-22411569 CACTTGCAGCCTTTATCTCCTGG + Intergenic
1121587358 14:95071296-95071318 CAGAGGGGGTCTTTCTCGCCGGG + Intergenic
1125362666 15:38880520-38880542 CAGAAGGGGTCTTTATCCCCGGG + Intergenic
1127580766 15:60337627-60337649 CAATTGGGGTCTTTAGAGCCTGG + Intergenic
1128301606 15:66569666-66569688 GAGTTGGGGCCTTCATGGACAGG + Intergenic
1132314803 15:100881759-100881781 CAGTTGGGGCCTTTATCGCCTGG - Intronic
1133203840 16:4221011-4221033 CAGATGAGGCCCTCATCGCCTGG + Intronic
1142450989 16:90173082-90173104 GAGTTGGGGCCTTGACAGCCTGG - Intergenic
1144667368 17:17111363-17111385 CTGCTGGGGCCTTCATGGCCAGG - Intronic
1146643018 17:34555355-34555377 CAGTTGGGGCCTTCTTAGCCTGG - Intergenic
1147421047 17:40322322-40322344 CAGTTGGGACCTTGCTTGCCTGG + Intronic
1148167960 17:45496791-45496813 GGGTTGGGGCCTTTATTTCCTGG + Intergenic
1148280861 17:46346163-46346185 GGGTTGGGGCCTTTATTTCCTGG - Intronic
1148303089 17:46564098-46564120 GGGTTGGGGCCTTTATTTCCTGG - Intronic
1149004926 17:51795657-51795679 CACTTGGGTCCTTTACCTCCTGG - Intronic
1150399141 17:64843206-64843228 GGGTTGGGGCCTTTATTTCCTGG + Intergenic
1152521736 17:80860434-80860456 CAGTTGGGGACCTGATGGCCTGG - Intronic
1155314116 18:24554135-24554157 CAGTTCTGACCTTTATCTCCAGG + Intergenic
1160646492 19:195966-195988 GAGTTGGGGCCTTGACAGCCTGG + Intergenic
1161560338 19:4969396-4969418 CGGTTGGGGCGTTAACCGCCCGG + Intronic
1162067646 19:8136045-8136067 CAGTGGTGGCCTTTGTCACCTGG - Exonic
930836798 2:55802741-55802763 CAGTTTGGGCCTTTATCCTCTGG - Intergenic
931150369 2:59566404-59566426 CAGTTTTGGCCTTTATCAGCAGG - Intergenic
933296556 2:80497717-80497739 CAGTTGGCTCCTTTAAGGCCAGG - Intronic
939018925 2:136935798-136935820 CAGTTGGGACAATTATGGCCAGG + Intronic
940858119 2:158745552-158745574 CAGCTGTGGCCTTTCCCGCCAGG - Intergenic
944806137 2:203283098-203283120 CACTTGAGGCCTTGATCTCCTGG - Intronic
947388078 2:229612287-229612309 CAGTTGAAGCCTTTCTGGCCTGG - Intronic
1176000390 20:62828947-62828969 CCGTTGGGGCCCTTCTCTCCCGG - Exonic
1176279015 20:64290250-64290272 GAGTTGGGGCCTTGACAGCCTGG - Intergenic
950633576 3:14299657-14299679 CATTTGGGGCCTTTCTTACCTGG - Intergenic
951056211 3:18149198-18149220 CAGTTGGGGCCCTTTTCCTCAGG - Intronic
958703893 3:97628955-97628977 TATTTGGAGCCTTTATTGCCCGG + Intronic
963706989 3:148699417-148699439 CAGGTGGGGCCTTTATAGCTAGG - Intronic
968371189 3:198223560-198223582 GAGTTGGGGCCTTGACAGCCTGG - Intergenic
968797366 4:2716433-2716455 AAGTAGGGGCCTGTATCCCCAGG - Intronic
975996845 4:80325165-80325187 CAGTTGTTGCCTTTTTTGCCAGG - Intronic
978754299 4:112285988-112286010 CAGCTGGCGCCTTTCTCACCAGG + Intronic
986001882 5:3637063-3637085 CAGGTGGGACCTTTATCCTCAGG + Intergenic
1002131364 5:177083971-177083993 CAATTCGGGGCTTTATCCCCAGG + Intergenic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1002660029 5:180785563-180785585 CACTTGGGGCCTTGAGCTCCAGG - Intergenic
1002730428 5:181329106-181329128 GAGTTGGGGCCTTGACAGCCTGG - Intergenic
1002754104 6:144998-145020 GAGTTGGGGCCTTGACAGCCTGG + Intergenic
1007128973 6:39451764-39451786 CAGTTAGGGTTTTTATCACCTGG - Intronic
1010937760 6:81882240-81882262 CTGTTGGGACCTTTTTCTCCTGG - Intergenic
1021480625 7:21111654-21111676 AAGTTGGGGCCTGTATAGCCAGG - Intergenic
1024075573 7:45816279-45816301 GAGTTGGGGCCTTGACAGCCTGG - Intergenic
1032052098 7:128656026-128656048 GAGTTGGGGCCTTGACAGCCTGG - Intergenic
1033666036 7:143441565-143441587 CAGTTGGGAACTCTATCTCCTGG + Intergenic
1035764616 8:2096187-2096209 CAGCTGGGGGCTTTGTCCCCGGG - Intronic
1036631737 8:10520744-10520766 CAGTTTGGGCATCTATCACCCGG - Intergenic
1040101594 8:43511500-43511522 CAGTTGGGGCCTTAATGGGCTGG + Intergenic
1047930209 8:129721028-129721050 CATGTGGGGCCTTGATCCCCTGG - Intergenic
1051284292 9:15480178-15480200 CATTTGGGGCCATTCTCTCCAGG - Intronic
1056529108 9:87471187-87471209 CTGTTGGACCCTTTATCTCCTGG + Intergenic
1058478069 9:105361169-105361191 CAGTTGGGTCTTTTGTCTCCAGG + Exonic
1059536681 9:115087177-115087199 CAGTTGGGGCCTTTCCAGCCAGG + Exonic
1061267034 9:129512230-129512252 CAGATGGGGCCCTTATCACCTGG - Intergenic
1062754838 9:138281616-138281638 GAGTTGGGGCCTTGACAGCCTGG - Intergenic
1203578746 Un_KI270745v1:25785-25807 GAGTTGGGGCCTTGACAGCCTGG - Intergenic
1186896473 X:14009071-14009093 CAGTTGGGGCTTCTACCGACCGG + Exonic
1187327470 X:18304861-18304883 CAGTTGGGGCATGTACCACCTGG + Intronic
1189260946 X:39678492-39678514 CAGTGGGGACATTTATCACCCGG + Intergenic
1192052913 X:67743723-67743745 AAGTTGGGGCTTATATCACCTGG - Intergenic
1193076027 X:77356595-77356617 AATTTGGGGCCTTTATCTTCAGG - Intergenic
1198609589 X:138383093-138383115 CAGCTGGGGCCCGTATCACCTGG - Intergenic
1200114355 X:153763642-153763664 CAGGTGGGGTCTTTGTGGCCAGG - Intergenic
1202381365 Y:24278403-24278425 GAGTTGGGGCCTTGACAGCCTGG - Intergenic
1202489420 Y:25391723-25391745 GAGTTGGGGCCTTGACAGCCTGG + Intergenic