ID: 1132318104

View in Genome Browser
Species Human (GRCh38)
Location 15:100905000-100905022
Sequence CCTGGGTGCCATGTATCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132318104 Original CRISPR CCTGGGTGCCATGTATCACC TGG (reversed) Intronic
901677835 1:10897286-10897308 CCTGGGTCTCATGTAGCACTGGG + Intergenic
905012023 1:34754328-34754350 CCAAGGTGCCCTGTATCAGCAGG - Intronic
905201770 1:36321058-36321080 TCTGGGTCCCCTGCATCACCTGG - Exonic
907286337 1:53382850-53382872 CCTGGGCTCCATGTGTCTCCTGG - Intergenic
908644613 1:66264001-66264023 CCTGGGTGCCAGGGATCAAGCGG + Intronic
916607530 1:166358089-166358111 CCTGGAAGCCTTGAATCACCAGG + Intergenic
920870549 1:209790768-209790790 CCTGGGTCCCATGCCTGACCAGG - Exonic
1063928920 10:11009616-11009638 CCTGAGTGACATGTATTACGAGG + Intronic
1065118346 10:22504005-22504027 CCCGGGTGTCATTTATCACCAGG + Intergenic
1067635370 10:47998136-47998158 CCTGGGTTTCATGTCTCAGCTGG - Intergenic
1069747412 10:70724562-70724584 CCATGGTGCCATGTGTCACACGG + Intronic
1072549914 10:96469548-96469570 CCTGGGTGACAGCTGTCACCTGG + Intronic
1074529742 10:114289080-114289102 CCTGGCTGCCATACACCACCAGG - Exonic
1077910429 11:6567839-6567861 ACTGGCTGCCAAGTATCAGCAGG + Exonic
1080138883 11:28890939-28890961 ACTGGGTGCCATGGAGCAGCGGG - Intergenic
1080503035 11:32888241-32888263 ACTGGGTGCCATGGAGCAGCGGG + Intergenic
1081866351 11:46362527-46362549 GCTGTCTGCCAGGTATCACCAGG + Intronic
1082997089 11:59263167-59263189 ACTGGATGCCATGTGGCACCAGG + Intergenic
1083294158 11:61706329-61706351 CCTGGGTGCCATGTCTCTTTCGG + Intronic
1083592363 11:63903190-63903212 CCTAGGAGCCATGTCTCACAGGG + Intronic
1084001256 11:66296404-66296426 CCTGGGCCCCATGGATCATCAGG - Exonic
1086337444 11:85812989-85813011 TCTGGGTGCCTTGTATCATCTGG + Intergenic
1089735552 11:120548162-120548184 CCTGGGTGCCAGGCAGCACAAGG - Intronic
1090277743 11:125431683-125431705 CATGGGTGCCATCTATCCTCAGG - Exonic
1091313967 11:134597697-134597719 CCTGGGTGCCCTGCACCAACAGG + Intergenic
1091788109 12:3255312-3255334 CCTGGGGGCCATGTCTCCTCAGG - Intronic
1094092041 12:26661427-26661449 CCTGGGCGACATGTCTTACCTGG - Intronic
1101603901 12:106233359-106233381 ACTGGGTGCCATGGAGCACATGG - Intergenic
1102828490 12:115972099-115972121 CCTGGTTGCCATGGAGCCCCAGG - Exonic
1105809921 13:23985925-23985947 CCTGGGTACTAAGTATCCCCTGG + Intronic
1112025518 13:95407568-95407590 CCTGTGTACCAAGTATCACCTGG - Intergenic
1113460744 13:110480225-110480247 CCAGGGTCCCCTCTATCACCAGG - Exonic
1116432545 14:44863709-44863731 CCAGGGTTTCATGTATCAGCTGG + Intergenic
1124583798 15:30986849-30986871 CCTGGGTGCCAGGTCTGTCCTGG - Intronic
1126917476 15:53482192-53482214 CCTGGGTGACATACATCTCCTGG - Intergenic
1127534769 15:59879956-59879978 ACTGGATGTCAAGTATCACCTGG + Intergenic
1128674829 15:69600837-69600859 CCTGGGTGCTATATTTCACTGGG - Intergenic
1130543911 15:84840866-84840888 CCCGGGTGCCATGTCTCCGCCGG - Exonic
1132318104 15:100905000-100905022 CCTGGGTGCCATGTATCACCTGG - Intronic
1133908702 16:10045155-10045177 CCTTGGTGCCTTCCATCACCAGG + Intronic
1135847650 16:25933341-25933363 CCTGGGAACCAATTATCACCAGG - Intronic
1137961423 16:52885473-52885495 CCTGGGTGCCATATAGCCTCTGG + Intergenic
1141252350 16:82369972-82369994 CCTGGGTGGCATCTGTCTCCAGG + Intergenic
1142321639 16:89386980-89387002 CCTGGGAGCCCTGTATCGACTGG + Intronic
1145998549 17:29118066-29118088 TCTGGCTGCCATCTACCACCTGG - Exonic
1147832924 17:43309794-43309816 CCTTGGTGTCATCCATCACCTGG + Intergenic
1148610787 17:48963222-48963244 CCTGGGTGGCACCTTTCACCAGG - Intronic
1150229889 17:63544098-63544120 CCTGGGTGCCCTGGAGCACAAGG - Exonic
1152109610 17:78350451-78350473 CCTGGGTCCCAGGTGACACCTGG + Intergenic
1152519110 17:80845171-80845193 CCTGGGTGCCATGGAGCAGGTGG - Intronic
1157922882 18:51731844-51731866 ACTGGGTGACATGTAACAGCGGG - Intergenic
1158615293 18:58981527-58981549 CCTTGATGCCATGCATCAGCTGG - Exonic
1160569253 18:79805637-79805659 CCTGGTGGCCATGTACCACCTGG + Intergenic
1162322993 19:9980813-9980835 CCTGGTTGCCCTGTGGCACCCGG + Exonic
1165403793 19:35618103-35618125 CCTGGCTGCCTTGGAGCACCTGG + Exonic
1165958200 19:39515203-39515225 CCTGGGCCCCATGAATAACCAGG + Exonic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1166811655 19:45517952-45517974 CCGGGGTGTCAAGTATAACCAGG + Exonic
1167109633 19:47451711-47451733 CCTGGGTGCATTGTATCAGGAGG - Intronic
1167566736 19:50261614-50261636 CCTGCGAGCCAGGTATCCCCGGG - Exonic
1168219679 19:54951658-54951680 CCTGGCTGCTGTGTATCACGTGG + Intronic
1168286409 19:55336737-55336759 CCAGTGTCCCATATATCACCCGG - Intergenic
1168494621 19:56838897-56838919 CCTGGGTGCCATCTTTGATCGGG - Intronic
926703227 2:15818140-15818162 CCTGGGTGCCAGGCAGCACTGGG - Intergenic
927638280 2:24831661-24831683 CCTGGCTGCCATCTTTCCCCGGG - Exonic
927848299 2:26483409-26483431 GCTGGGTGACAGGTATCACAAGG - Intronic
928912356 2:36434956-36434978 TACGGGTGCCATGTGTCACCAGG - Intronic
931640197 2:64374992-64375014 TCTGTGTCCCATGTATCTCCGGG - Intergenic
935737860 2:106120503-106120525 CCTCGGTGCCATTTCTCACCTGG + Intronic
941468737 2:165859614-165859636 CCTGGGTAACCTGTGTCACCTGG + Intronic
948942707 2:241204141-241204163 CCTGTGTGCCAGGACTCACCCGG + Intronic
1168958013 20:1848308-1848330 CCCAGGTGCCATATCTCACCTGG - Intergenic
1169084767 20:2819901-2819923 ACAGGGTACAATGTATCACCTGG - Intronic
1170912360 20:20585746-20585768 CCTGGGTGCCCTGCATGGCCTGG - Intronic
1171170980 20:23015170-23015192 CTTGCCTGCCTTGTATCACCAGG - Intergenic
1175697935 20:61116593-61116615 CCTGGGTGCCAAGTTTCTGCTGG - Intergenic
1181858215 22:25798054-25798076 CCTGGCAGCCATCTACCACCTGG + Exonic
1182440767 22:30362602-30362624 TCTGGTTGCCATGTACAACCAGG + Intronic
1183451210 22:37896290-37896312 CCCGGGTGTATTGTATCACCTGG + Intergenic
1183684593 22:39354435-39354457 CCTTGGTGCCATGGATATCCAGG - Intronic
1183706743 22:39479004-39479026 CCTGGCTGCCAGGAAGCACCTGG + Intronic
1185014260 22:48334153-48334175 CCTGGGGGTCATGTATCAGAGGG - Intergenic
954291447 3:49652160-49652182 TCTGGGTGCCATGTTTGGCCAGG - Exonic
954535892 3:51358992-51359014 CTTGGGTGCCAGGTAGCAGCAGG - Intronic
955933811 3:64083199-64083221 TCTGGGTGACATATATCTCCTGG + Intergenic
956797945 3:72732960-72732982 CCTTGGTGCCAAGTATCAGCAGG - Intergenic
957229488 3:77493638-77493660 CCTGGGTGCCTTCTTTCCCCTGG + Intronic
957954708 3:87170686-87170708 CCTGTGGGCAATGTATCAGCAGG - Intergenic
960634267 3:119768222-119768244 CCTGGGTGCCATGAATGACAGGG - Intergenic
965239366 3:166174848-166174870 TCCTGGTGTCATGTATCACCCGG - Intergenic
968222280 3:196947960-196947982 CGTGCGTGCCATGTCTCGCCAGG + Exonic
972353309 4:38257701-38257723 CCTGGGAGCCAGGGACCACCAGG - Intergenic
977411806 4:96675431-96675453 CCTTTTTGCCATGTATCACAAGG - Intergenic
979010137 4:115356228-115356250 CCTGGGTGACTTGGGTCACCAGG - Intergenic
982845741 4:160249828-160249850 CCTGTGTGGCATGTATTAGCAGG + Intergenic
985041313 4:185894296-185894318 CCTGGGGGCCATGAAGCACCTGG - Exonic
987678388 5:21105076-21105098 CCAGGGTTCCATTTATTACCTGG - Intergenic
999610171 5:153360833-153360855 GCTGGATGCTTTGTATCACCTGG - Intergenic
1000303065 5:159972656-159972678 CATGGGTGCCAGGTACCACGCGG + Intergenic
1002450184 5:179314317-179314339 CCTGGCTGCCACGTCTCACTGGG + Intronic
1003398304 6:5771692-5771714 CCTGGGTTCCATTAAGCACCAGG + Intergenic
1009921592 6:70068428-70068450 CTTGGGGGCCTTGTATCCCCAGG - Exonic
1012252284 6:96992212-96992234 CCCGGGAGCCATGGATCCCCTGG - Intronic
1016939775 6:149474384-149474406 CCCGGGTGCCCTGGAGCACCCGG - Exonic
1023155519 7:37247738-37247760 CCTGGGTGCAAGGTGCCACCTGG + Intronic
1023967722 7:44971672-44971694 CCTGGCTGCCATATTGCACCTGG - Exonic
1024253312 7:47522096-47522118 TCTGGGTCCCAGGTATCAGCAGG + Intronic
1032487161 7:132296690-132296712 CCTTGGTGGCATGAATCATCTGG - Intronic
1034316401 7:150137199-150137221 CCTGGGTGCCCTGTGTCAGATGG + Intergenic
1036122842 8:6036719-6036741 TCTGGGTGGAATGTTTCACCAGG - Intergenic
1036238197 8:7060618-7060640 CCTGGTGGCCATTTAGCACCAGG + Intergenic
1038008360 8:23453625-23453647 CCTGTTAGCCAAGTATCACCAGG - Intronic
1040066055 8:43144908-43144930 CCTGAGTGCCTTATATCACAAGG - Intronic
1040397435 8:47013066-47013088 CCTGGGTGGCATGTTTAACAAGG - Intergenic
1043637148 8:82400069-82400091 CCTGGGTTCCATGCATTACAGGG + Intergenic
1045494728 8:102698819-102698841 CCTGGGTGCTTTGGATCCCCTGG + Intergenic
1047547962 8:125838592-125838614 CCTGGGGGCCATGGATCTCTGGG + Intergenic
1049258288 8:141625374-141625396 CCAGGGTGCCCTGACTCACCAGG - Intergenic
1049682986 8:143927955-143927977 CCTGCGTGCCGCGGATCACCAGG + Exonic
1050061079 9:1710462-1710484 CATGGGAGTCATGTATCACCTGG - Intergenic
1052406490 9:28067580-28067602 CCTGTGTGCCATGTTTTACAGGG - Intronic
1053294646 9:36903899-36903921 CCAGGCTGCCATGACTCACCAGG + Intronic
1055792212 9:79935008-79935030 CCTGGGGGCCAGGTATGACTTGG + Intergenic
1062502443 9:136857295-136857317 CCCGGGTGCCAGGCCTCACCTGG - Exonic
1194609483 X:96023496-96023518 CCTGGGAGCAGGGTATCACCAGG + Intergenic
1196695629 X:118608269-118608291 CCAGGGTTTCATGTATCAGCTGG - Exonic