ID: 1132318633

View in Genome Browser
Species Human (GRCh38)
Location 15:100909038-100909060
Sequence GGGTTTGCACGCGCATGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 73}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132318633 Original CRISPR GGGTTTGCACGCGCATGGAG GGG (reversed) Intronic