ID: 1132318633

View in Genome Browser
Species Human (GRCh38)
Location 15:100909038-100909060
Sequence GGGTTTGCACGCGCATGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 73}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132318633 Original CRISPR GGGTTTGCACGCGCATGGAG GGG (reversed) Intronic
900773858 1:4566918-4566940 GGGCTTGCACTGGCATGAAGAGG + Intergenic
903145474 1:21369289-21369311 GGGTCTGCAGGCCCATAGAGGGG + Intergenic
912750861 1:112286224-112286246 GTGTTTGCATGCACGTGGAGTGG + Intergenic
913485341 1:119328143-119328165 GGGTTAGCAGGGGCCTGGAGTGG + Intergenic
915902243 1:159855287-159855309 GGGATTGCAGGGGCCTGGAGGGG - Exonic
918355671 1:183705101-183705123 GGGTTTAAAGGCTCATGGAGAGG + Intronic
922023165 1:221724721-221724743 GTGTGTGCATGCACATGGAGGGG + Intronic
1067552671 10:47246452-47246474 GTGTGTGCATGTGCATGGAGAGG - Intergenic
1073037294 10:100572960-100572982 GTGTGTGCACACGCATGGGGGGG + Intergenic
1081048781 11:38311363-38311385 GTGTTTGCATGTGCATGGATGGG + Intergenic
1082632125 11:55555780-55555802 GGGTTTAAAGGCTCATGGAGAGG - Intergenic
1084179322 11:67438650-67438672 GGGTATGCACGCGCAGGCAGGGG - Exonic
1084353140 11:68618129-68618151 GGATTTGCCCGCCCATGGAGAGG + Intergenic
1085863206 11:80257936-80257958 GGGAGTGCAGGCGCATGGCGCGG + Intergenic
1105026751 12:132853968-132853990 GGCTTTGCAGGCGCCTGGTGTGG - Intronic
1118942149 14:70347919-70347941 GGGTTTGAAGGCTCATGGAGAGG - Intronic
1122630449 14:103105148-103105170 GGGAGTGCGCGCGCGTGGAGGGG + Intronic
1124049313 15:26180248-26180270 GGATCTGCAAGCGCATGGAGTGG + Intergenic
1125680863 15:41529478-41529500 GGGTCTGCACCACCATGGAGAGG - Exonic
1129153191 15:73702170-73702192 GGGTTAGCAGGGGCAGGGAGCGG + Intronic
1130051877 15:80490589-80490611 GGGTCTGCATCCACATGGAGGGG - Intronic
1130888158 15:88111002-88111024 GGCTGTGCAAGAGCATGGAGGGG + Intronic
1131843122 15:96459038-96459060 GGGTTTGGAATGGCATGGAGGGG - Intergenic
1132318629 15:100909007-100909029 GGGTTTGCACACGCATGTGGAGG - Intronic
1132318633 15:100909038-100909060 GGGTTTGCACGCGCATGGAGGGG - Intronic
1132318644 15:100909101-100909123 GGGTTTGCACACGCACGGAGGGG - Intronic
1132318666 15:100909242-100909264 GGGTTTGCACACACACGGAGGGG - Intronic
1132318720 15:100909573-100909595 GGGTTTGCACACACACGAAGGGG - Intronic
1133050866 16:3116546-3116568 GGGTAAGCACTCGCCTGGAGGGG + Exonic
1133277244 16:4646462-4646484 GGGCTTGCCTGGGCATGGAGGGG + Intronic
1136623123 16:31443099-31443121 GTGTGTGCATGCGCATGGCGCGG - Intronic
1138431808 16:56973564-56973586 GTGTGTGCACACGCATGGGGAGG + Intronic
1139295346 16:65895649-65895671 GGGTTAGCATGCACATGGACAGG - Intergenic
1142414105 16:89932075-89932097 TGGTTTGCTCTCCCATGGAGGGG + Intronic
1157920221 18:51706828-51706850 GGGTTTGAAGGCTCATGGTGAGG - Intergenic
1158513848 18:58114813-58114835 GGCTTTGCAAACGCAGGGAGGGG - Intronic
1163939111 19:20476731-20476753 GGGTTTAAAGGCTCATGGAGAGG + Intergenic
1165135564 19:33666248-33666270 GGGCTTCCACGGGCATGGAGGGG - Intronic
1167443577 19:49524511-49524533 GGGCCTTCAGGCGCATGGAGGGG - Exonic
930253612 2:49064084-49064106 GTGTTTGCACATGCATGGTGGGG + Intronic
932825645 2:74936943-74936965 GGGTTTTCAACTGCATGGAGGGG - Intergenic
933667011 2:84971705-84971727 GGGTTTGCACTGTCATGGGGCGG + Intronic
939697184 2:145341179-145341201 GGGTTTACAAGCTAATGGAGAGG + Intergenic
940571557 2:155442525-155442547 CGGTTTGCAAACTCATGGAGAGG + Intergenic
942620209 2:177837093-177837115 CGGTTTGCACACGGAGGGAGAGG - Intronic
948518570 2:238521778-238521800 GGGTTTGCAGGAGCACGGTGTGG + Intergenic
948599754 2:239101516-239101538 GGGGTTGCAGGGGCAAGGAGAGG - Intronic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175985829 20:62763800-62763822 GGATTTGAGCGCCCATGGAGGGG + Intergenic
1176023560 20:62974701-62974723 GGCTGTGCTCGTGCATGGAGTGG + Intergenic
1176217620 20:63955773-63955795 GGCTTTGCAAGAGCATGAAGTGG - Intronic
1179667232 21:42921286-42921308 GGGTTTAAAGGCTCATGGAGAGG + Intergenic
953160583 3:40415857-40415879 GTGGGTGCACCCGCATGGAGTGG + Exonic
962869822 3:139478072-139478094 GGGTTTTCATGGGCATTGAGGGG + Intronic
976227443 4:82806767-82806789 GGGTTTGCAGGTACATGGATTGG + Intergenic
976299787 4:83506890-83506912 GGGTTTGAAGGCCCATGGAGAGG + Intronic
982901097 4:161003610-161003632 GGGTGTGCACACGCTTGGGGTGG - Intergenic
999254205 5:150200805-150200827 GAGTTTGCAGGGGCAGGGAGTGG + Intronic
1003425546 6:5996189-5996211 GGGCTTGGAAGCGCGTGGAGGGG + Intergenic
1006944767 6:37777973-37777995 GGCTTTGCAGGCTCATGGAGAGG - Intergenic
1008507898 6:52248518-52248540 AGGATTGCACAGGCATGGAGGGG - Intergenic
1012749582 6:103140567-103140589 GGGTTTGCAAATGCTTGGAGTGG - Intergenic
1015002773 6:128239910-128239932 GCGTGTGCACACGCATGTAGTGG - Intronic
1022840612 7:34160732-34160754 GGGTGTGCACGTGCCTGAAGAGG + Intergenic
1032709605 7:134450414-134450436 GTGTGTGCACGTGCCTGGAGGGG + Intronic
1037666129 8:20971764-20971786 GGTTTTGCACATGCACGGAGGGG - Intergenic
1042158277 8:65867109-65867131 GGGTTTGAAGGCTCATGGAGAGG - Intergenic
1046657141 8:116907062-116907084 GGGCTTTCACAGGCATGGAGAGG + Intergenic
1048985447 8:139732428-139732450 GGGTCTGCACCCCAATGGAGGGG + Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1058424541 9:104864972-104864994 GGCTGTGCACGTGCATGGTGTGG + Intronic
1060000980 9:119958447-119958469 GGGTTTGAACCCGCATGGGTGGG + Intergenic
1192282326 X:69699812-69699834 GGGTTTAAAGGCTCATGGAGAGG + Intronic
1192282333 X:69699845-69699867 GGGTTTAAAGGCTCATGGAGAGG + Intronic
1200049104 X:153419321-153419343 GGGTGTGCACTGGCATGGAAGGG - Intronic