ID: 1132321601

View in Genome Browser
Species Human (GRCh38)
Location 15:100929662-100929684
Sequence GAGGAACAGGTCAGAGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132321601_1132321608 6 Left 1132321601 15:100929662-100929684 CCCACATCTCTGACCTGTTCCTC 0: 1
1: 0
2: 0
3: 24
4: 306
Right 1132321608 15:100929691-100929713 GATTCCTGCCTGAACGTGCTGGG 0: 1
1: 0
2: 1
3: 3
4: 84
1132321601_1132321607 5 Left 1132321601 15:100929662-100929684 CCCACATCTCTGACCTGTTCCTC 0: 1
1: 0
2: 0
3: 24
4: 306
Right 1132321607 15:100929690-100929712 GGATTCCTGCCTGAACGTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132321601 Original CRISPR GAGGAACAGGTCAGAGATGT GGG (reversed) Intronic
902759941 1:18574606-18574628 GTGTAACAGGACAGAGTTGTGGG + Intergenic
903320134 1:22538247-22538269 AAGGAACAAGGAAGAGATGTTGG + Intergenic
903488295 1:23707858-23707880 GAGGAGGGGGTCAGAGATGATGG + Intergenic
903781941 1:25826309-25826331 CAAACACAGGTCAGAGATGTTGG - Exonic
905272686 1:36797170-36797192 GAGGACCAGATGAGAGATGGGGG - Exonic
906608994 1:47189441-47189463 GACGAAGAGGTCAGATATTTGGG + Intronic
908945824 1:69495357-69495379 GAGAAAAATGTCAGAGATTTTGG - Intergenic
909261763 1:73499149-73499171 TAGGAACAGATCAGAGGTCTAGG - Intergenic
909561759 1:77015863-77015885 GAGGAAAAGGGGAGAGAGGTGGG + Intronic
909946654 1:81671162-81671184 GAGGAACAGGGGAGAGATGAAGG - Intronic
910612919 1:89164637-89164659 CAGGAATAGGCCAGAGAAGTTGG + Intronic
911195119 1:94986795-94986817 GAGGAAAAGGTGATGGATGTGGG - Intronic
911273517 1:95832231-95832253 GAGGCAAAGGACAGTGATGTTGG - Intergenic
912172799 1:107121227-107121249 GTGGAAACAGTCAGAGATGTTGG - Intergenic
912572337 1:110633728-110633750 GAGGAAAAGGTCAAAGGTTTTGG + Intergenic
912927684 1:113928185-113928207 TAGGAACATGTCAGAGAGTTAGG + Intergenic
914744329 1:150490528-150490550 GAGGAAGAGCTCAGAGATCTAGG + Intronic
915940812 1:160117170-160117192 GAGGAAGAGGTCATAGCTGCAGG + Intronic
917028866 1:170668231-170668253 GAGGAACAGGTCATAAAAATAGG + Intronic
917167269 1:172126296-172126318 GGGTAACTGGTAAGAGATGTGGG + Intronic
917343354 1:174003540-174003562 GTGATCCAGGTCAGAGATGTTGG - Intronic
917733523 1:177899749-177899771 GAGGAAGAAGTCAGAGATGGAGG + Intergenic
920672462 1:208015091-208015113 GAGAATTAGGTCAGAGATGGAGG + Intergenic
921067431 1:211632757-211632779 GAGGAACAGGAAGGCGATGTCGG - Intergenic
922199419 1:223389490-223389512 GAGGAACAGGTCAGAGTTTGAGG - Intergenic
922282956 1:224143340-224143362 CAGGCACAGCTCTGAGATGTCGG - Intronic
922502030 1:226104393-226104415 GAGGAACTGGTCCTGGATGTGGG + Intergenic
923778680 1:237002147-237002169 CAGCAACAGGTCAGTGATGAAGG - Intergenic
923789778 1:237102187-237102209 GAGGAACAGGACAGACAGGTGGG + Intronic
924577810 1:245296413-245296435 GCAGAATAGTTCAGAGATGTGGG + Intronic
1063111227 10:3039155-3039177 GAGGAACTGGTGGGAGATGATGG + Intergenic
1063441186 10:6074704-6074726 GGGGCCCAGGTCAGAGATGCAGG + Intergenic
1063824860 10:9884431-9884453 CAGGCACACATCAGAGATGTGGG + Intergenic
1067555631 10:47267860-47267882 GAGCAACAGGGCAGAGGAGTGGG + Intergenic
1069541350 10:69296399-69296421 GAGGAGCAGGGCAGAGCTCTGGG - Intronic
1069795211 10:71047413-71047435 GAGGGACAGTTCTGAGAAGTGGG + Intergenic
1069967249 10:72130532-72130554 CAGGAAGAGTTCAGATATGTAGG - Intronic
1071414268 10:85426263-85426285 CAGTAACAGGTAAGTGATGTTGG - Intergenic
1072459199 10:95604085-95604107 GAAGAGCGGGTCAGTGATGTTGG + Intergenic
1074458298 10:113614320-113614342 GAGGAACAGCTCAGGGATAAGGG + Intronic
1074993322 10:118732012-118732034 TAGGAAGAGGCCAGACATGTAGG + Intronic
1075389123 10:122079639-122079661 GAGGAGCAGGACAGAGAGGCTGG + Intronic
1076253079 10:128998101-128998123 GAAGAGCAGCTCAGAGATGATGG - Intergenic
1076553890 10:131309206-131309228 GAGCAGAAGGGCAGAGATGTGGG + Exonic
1077818035 11:5707422-5707444 CAGGAAGAGGCCAGAGATGTGGG - Intronic
1078456957 11:11482909-11482931 GAGGAGCATGTCAGAAATGCAGG + Intronic
1079886609 11:25998187-25998209 CAGCAACAAGTCAGGGATGTTGG - Intergenic
1080015776 11:27505463-27505485 GAGGAAGATGTCAGAGACTTAGG + Intronic
1080243390 11:30152996-30153018 GAGGAATGAGGCAGAGATGTAGG + Intergenic
1080320693 11:31005895-31005917 GAGGAAAGGGTCGGAGATATTGG - Intronic
1081756640 11:45549424-45549446 GAGGAACAGATCAGAGGAGCTGG + Intergenic
1082099851 11:48163525-48163547 GATGAGCAGGTCAGTGGTGTCGG - Exonic
1082144561 11:48650817-48650839 GAGAAACGGGTTAGGGATGTGGG + Intergenic
1083319520 11:61837360-61837382 GAGGAACTAGTAAGAGATGGTGG + Intronic
1083600885 11:63946910-63946932 GAGGAACAGCACAGACAAGTGGG - Intronic
1085249213 11:75131162-75131184 GAGGGGCAGGTCAGCGCTGTAGG + Intronic
1088675505 11:112188624-112188646 GAGGACAAGGGCAGAGATGATGG - Intronic
1088932340 11:114364845-114364867 GAAGACTAGGTCAGAGAGGTTGG + Intergenic
1089212669 11:116816514-116816536 CTGGAACAGGCCAGAGATGAGGG + Intergenic
1089976402 11:122735791-122735813 GAGGCAGAGTTCAGAGTTGTGGG + Intronic
1091102015 11:132883478-132883500 GAGGAACAGCTCAGTGAGGTTGG + Intronic
1091209149 11:133841989-133842011 GAGGAACTGGGCAGAGAAGATGG - Intronic
1091710561 12:2737300-2737322 GAGGAAATGGTCAGAGAGGTAGG + Intergenic
1091718937 12:2798342-2798364 GAGAAACTGCTGAGAGATGTTGG + Intronic
1092286495 12:7131722-7131744 GAGGCTGAGGTCAGAGATGCAGG - Intronic
1092728778 12:11509089-11509111 GAGGAAATGGTCAGAGAGGTAGG - Intergenic
1092983598 12:13822524-13822546 GAGGAACAGTTAAGAAATGAAGG + Intronic
1093975350 12:25415102-25415124 GAGGCATAGGTGAGAGATGATGG + Intronic
1095193270 12:39283564-39283586 GAAGCCCAGGTCAGAGATGATGG + Intergenic
1095323003 12:40852331-40852353 GAGGAAACGTTCAGAGAAGTTGG + Intronic
1095330581 12:40956900-40956922 GGGGTTCAGGTGAGAGATGTGGG + Intronic
1095544909 12:43354920-43354942 GAGGAACAGGTGGCAGAGGTAGG + Intronic
1096266817 12:50130074-50130096 GAGGAACAGTACAGAAATGTGGG + Exonic
1099026401 12:77469546-77469568 TAGGAAGAGGACAGAGATCTAGG - Intergenic
1100457943 12:94770555-94770577 CATGATCAGGTTAGAGATGTAGG + Intergenic
1100723481 12:97384075-97384097 GAGGAAAGGGAGAGAGATGTGGG + Intergenic
1101434846 12:104655656-104655678 GAGCAATGGGTAAGAGATGTGGG + Intronic
1101989249 12:109470938-109470960 GAGAGACAGTTCAGAGAAGTGGG - Intronic
1103167682 12:118784228-118784250 GAGCCAAAGGTAAGAGATGTAGG - Intergenic
1103326890 12:120127650-120127672 CAGGAAAAGGTGAGAGATGGAGG + Exonic
1104570705 12:129922848-129922870 GAGGGACAGGACAGAGACCTGGG + Intergenic
1104895519 12:132161863-132161885 GAGGAACAGCTCAGTGAGGAGGG - Intergenic
1104895545 12:132161974-132161996 GAGGAACAGCTCAGTGAGGAGGG - Intergenic
1105627906 13:22131307-22131329 GAGGAACAGGTCAGCTGTTTAGG + Intergenic
1110548158 13:76780099-76780121 AAGGAACAGATCAGAGGTTTAGG - Intergenic
1110860341 13:80340209-80340231 GAAGAACAGGTTAGAAATGCGGG + Intronic
1111029533 13:82577042-82577064 GAGGATTTGGGCAGAGATGTGGG + Intergenic
1111353005 13:87057843-87057865 TATGAACATTTCAGAGATGTAGG - Intergenic
1112205788 13:97322177-97322199 GAGGTACAGGGAAGAGGTGTGGG - Intronic
1112454111 13:99542607-99542629 TCAGAACAGGTCAGAGAGGTTGG - Intronic
1113088514 13:106593064-106593086 GAGGAAAAGTTCAGAGGTTTAGG - Intergenic
1113246700 13:108404372-108404394 GAGAAAGAGGTTAAAGATGTAGG - Intergenic
1114646886 14:24260905-24260927 GGGGAACAGGTTTGGGATGTTGG - Intronic
1115434671 14:33359156-33359178 GAGGAACAGGAGAGAGAAGAGGG + Intronic
1116066160 14:39985608-39985630 TAGGCACAGGTAAGGGATGTTGG + Intergenic
1116659677 14:47693083-47693105 AAGGAGCAGGCCAGAGGTGTTGG + Intergenic
1118680158 14:68232789-68232811 GAGTAAAAGCTCAGAGCTGTGGG - Intronic
1120414839 14:84206441-84206463 GGGGATCAGGAGAGAGATGTTGG - Intergenic
1120760808 14:88283516-88283538 GTGGAATATGTCAGAGGTGTGGG + Intronic
1120961437 14:90128633-90128655 GAGGAACAGGTGAGCCATGAAGG - Intronic
1124924098 15:34054714-34054736 GAAGAATAGGTAATAGATGTTGG + Intronic
1126680440 15:51197039-51197061 GAGGCACAGATCACAGATCTAGG + Intergenic
1129250089 15:74303896-74303918 GAGAAAAAGGTCAGAGTTGGGGG - Intronic
1130864417 15:87920122-87920144 GAGGGACAGGGCTGAGATTTAGG - Intronic
1130891651 15:88138529-88138551 GAAGATGAGGTCAGAGATGATGG - Intronic
1131675475 15:94666583-94666605 GGGGACCAGGTCAGAGATCCTGG + Intergenic
1132072376 15:98789848-98789870 GAGGAAGAAGTCAGAGAGGCGGG + Intronic
1132132409 15:99294879-99294901 GAGGAATAGATCAGAGTTGGGGG - Intronic
1132321601 15:100929662-100929684 GAGGAACAGGTCAGAGATGTGGG - Intronic
1132326596 15:100975153-100975175 CACGAGCAGGTCAGAGCTGTGGG + Intronic
1133615949 16:7477086-7477108 GAAAAAAAGGACAGAGATGTGGG - Intronic
1133948613 16:10370744-10370766 GAGGAAAAGGTCAGAGAGAAGGG + Intronic
1134115580 16:11545424-11545446 GAGGAAGGGGGCAGAAATGTTGG + Intergenic
1134674449 16:16079526-16079548 GAGGAAAAGCTCAGAAATGATGG + Intronic
1135620276 16:23949921-23949943 GAGGCACAGGGAAGAGGTGTGGG - Intronic
1137524939 16:49226718-49226740 GAGGATGAGGTCAGAGATAACGG - Intergenic
1137895204 16:52204684-52204706 GAAGATGAGGTCAGAGAGGTTGG + Intergenic
1137905335 16:52315974-52315996 GAGGGAGAGGTTAGAAATGTAGG + Intergenic
1138649337 16:58450112-58450134 GAGGCACAGGTAAGTGATGCTGG - Intergenic
1139264989 16:65630200-65630222 GAGGAAGAGACCAGAGCTGTAGG - Intergenic
1139582118 16:67879974-67879996 GAGGCAAGGGTCAGAGATGGAGG + Intronic
1141527112 16:84618468-84618490 GGGGAAGAGGTCAGGGAAGTGGG - Intergenic
1141582009 16:85005976-85005998 GAGGTACAGGCTAGAGATGAGGG - Intronic
1141878107 16:86840245-86840267 CAGGAAAAGGTCAGAGCTGATGG + Intergenic
1143316026 17:6034102-6034124 TAGGAAGAGGCCAGAGAGGTGGG + Intronic
1144308771 17:13993292-13993314 GTGAAAAATGTCAGAGATGTGGG + Intergenic
1145849197 17:28074847-28074869 AAGGCACAGGTCAGAGAAGAAGG + Intronic
1146901926 17:36594210-36594232 GGGGAATAGTTCAGAGATGAGGG + Intronic
1147863697 17:43539200-43539222 GAGAGGCAGGTCAGAGAGGTAGG - Intronic
1148113757 17:45162525-45162547 GAGGAGCAGGACAGAGAAGACGG + Exonic
1148132992 17:45273632-45273654 GAGGAACAGGTGAGTCATGCCGG + Intronic
1148193285 17:45695123-45695145 GAGGACCACGTTAGAGAGGTAGG + Intergenic
1148638743 17:49169144-49169166 GAGGAAGAAGACAGAGCTGTAGG - Intronic
1148910601 17:50940386-50940408 GAGGCACAGGTCAGAGAGAGGGG - Intergenic
1149422274 17:56522123-56522145 GATATACTGGTCAGAGATGTTGG - Intergenic
1150055720 17:62013679-62013701 AAGAAAGAGGTCAGAGATTTCGG + Intronic
1150203389 17:63379953-63379975 GAGGAACAGGCCATACGTGTTGG - Intronic
1150650114 17:67004698-67004720 GTGGATCAAGTCAGAGAAGTTGG - Intronic
1153119082 18:1699905-1699927 GAAGCTCAGCTCAGAGATGTAGG - Intergenic
1154980448 18:21499005-21499027 AAGGAACTGGTCAAATATGTGGG + Intronic
1155261206 18:24044262-24044284 GAGGCAAAGATCAGTGATGTGGG + Intronic
1155911503 18:31509314-31509336 GAAGAACAGGTGAAAGATTTTGG + Intronic
1156350128 18:36296542-36296564 GAGGGAGAGGTTAAAGATGTGGG + Intergenic
1158184100 18:54751726-54751748 GAGGAAGATGTAAGAGATATAGG + Intronic
1158407333 18:57171764-57171786 GAGTAACAAGTCTGAGATGAGGG + Intergenic
1160686465 19:439091-439113 GAGGAAGGGGTCAGAGAGGGCGG + Intronic
1161641295 19:5425065-5425087 GAGGAACTGGAGAGAGATCTGGG - Intergenic
1163566144 19:18052309-18052331 GAGGGACAGGCCAGAGGTGGGGG + Intergenic
1164421401 19:28096434-28096456 GAAAAAAAGGTCAGAGATGAGGG - Intergenic
1164585736 19:29474523-29474545 GAGGACCTGCTCAAAGATGTTGG + Intergenic
1165321290 19:35086823-35086845 GTGGGCCAGGGCAGAGATGTGGG + Intergenic
1166128634 19:40731878-40731900 CAGGAGGAGGTCAGAGATTTTGG + Intronic
1166811359 19:45516369-45516391 GAGGAAGAGCTCAGAGGTCTGGG + Intronic
1167453285 19:49584811-49584833 GAGGGAAAGGTTAGAGCTGTGGG + Intronic
1168011823 19:53539040-53539062 GAGGGACAGGTCCCTGATGTGGG + Intronic
1168206036 19:54851379-54851401 GAGGGCGAGGTCAGAAATGTGGG - Intronic
1168571499 19:57474858-57474880 GAGGAACAGGTGAGACATGAAGG + Intronic
930735559 2:54775063-54775085 GAGGCACAGGTGAGAAATGCTGG - Intronic
930845042 2:55894925-55894947 TAGGAAGGGGTCAGAAATGTAGG - Intronic
932033352 2:68213397-68213419 GAGGAAAAGGAGAGAGTTGTGGG + Intronic
933293431 2:80463099-80463121 CAGAAAAAGGTCAGAGATGGAGG - Intronic
933784367 2:85827355-85827377 GAGCATCGGGGCAGAGATGTGGG + Intergenic
934846881 2:97666952-97666974 GAGGAACAGGTCAGAGACCAAGG - Intergenic
935229758 2:101085325-101085347 CAGGAACAGAACAGAAATGTGGG + Intronic
935293254 2:101627439-101627461 GAGAACCAGGTCAGAATTGTGGG + Intergenic
936957774 2:118040582-118040604 GAGGGCCTGGTCTGAGATGTGGG - Intergenic
940697091 2:156993324-156993346 AAGAAAGAAGTCAGAGATGTGGG + Intergenic
941552551 2:166935222-166935244 AGGGAACAGGTCTGTGATGTGGG + Intronic
943772286 2:191731626-191731648 GAGAAAGAGGTGAGAAATGTTGG + Intergenic
944301575 2:198130271-198130293 GAAGAAAGAGTCAGAGATGTAGG - Intronic
944875366 2:203959166-203959188 GAGGCACAGCTCAGAGATGAGGG - Intronic
945731581 2:213543630-213543652 GTGGAACAGGATAGAGATCTCGG - Intronic
945989438 2:216381789-216381811 GAGAAGCAGGAAAGAGATGTGGG - Intergenic
946359218 2:219209089-219209111 GAGGAAGAAGTCAGGGATGGGGG + Intronic
947544514 2:231001401-231001423 GAGGAACAGGACAAGGATGGGGG - Intronic
947979991 2:234400339-234400361 GAGGCACCGGTCAGAGAGGGAGG + Intergenic
948594371 2:239069996-239070018 GAGGACCAGGACAGAGAGGACGG - Intronic
1169073174 20:2746122-2746144 GAGGAACATGTCGCACATGTGGG + Intronic
1173401414 20:42729462-42729484 GAAGAACAGGACTGAGATGTGGG + Intronic
1174585115 20:51602383-51602405 CAGGACCGGGTCAGAGGTGTAGG - Intronic
1175134342 20:56811617-56811639 AAAGAACAGGACAGAGATCTGGG + Intergenic
1175977956 20:62722587-62722609 GAGGCAGAGATCAGAGATGCGGG - Intronic
1176099758 20:63359587-63359609 GAGGACCACGTCCGAGATGTTGG + Exonic
1176667096 21:9697835-9697857 CAGGATCAGGGCAGACATGTAGG - Intergenic
1179005575 21:37511173-37511195 GAGAAAGAGGTTAGAGAAGTGGG + Intronic
1181558476 22:23685739-23685761 AAGGAACAGGCCAGACATGGTGG + Intergenic
1181854653 22:25773355-25773377 GAGGAAGAGGTGGGAGAGGTTGG + Intronic
1181958528 22:26605842-26605864 GATGACCAGGTCAGAGATGATGG + Intronic
1182917929 22:34052474-34052496 GAGGAATAAGTGAAAGATGTGGG + Intergenic
1183934182 22:41252784-41252806 GACGAACAGCTCAGAGACCTGGG - Intronic
1184421227 22:44384047-44384069 GAGGAAGGGGTCTGGGATGTGGG - Intergenic
1184478186 22:44732545-44732567 GAGCAGCTGGTCAGAGCTGTGGG + Intronic
1184820941 22:46908914-46908936 CAGGTACAGTTCAGAGATGCGGG + Intronic
949507818 3:4743391-4743413 GATGACCAGGGCAGAGTTGTGGG - Intronic
949829710 3:8200966-8200988 TAGGAAAAGCTCAGATATGTGGG + Intergenic
950583441 3:13878046-13878068 GAGGTCCAGGTCGGAGAGGTGGG - Intronic
952256084 3:31696937-31696959 GAAGAACACGTTGGAGATGTTGG - Intronic
953033387 3:39192050-39192072 GAGGAACAGGAGAGAGGTGGGGG - Intronic
953055876 3:39386847-39386869 GAGGAGCTGGTCGGAGGTGTGGG + Intronic
954258040 3:49419748-49419770 CAGAACCAGGGCAGAGATGTGGG - Exonic
956743755 3:72295157-72295179 AAGGAAGAGCTCAGAGGTGTGGG + Intergenic
956845478 3:73178362-73178384 GAGGAGCAGGTAAGAGCTGAAGG + Intergenic
957659390 3:83127492-83127514 TAGGAACTTGTCAGAAATGTCGG - Intergenic
958625188 3:96614259-96614281 GAGGAACAGGGTAGAGAGGAGGG + Intergenic
958902584 3:99905324-99905346 GAGGAACTGGTGAGATATCTAGG - Intronic
960147349 3:114217450-114217472 GAGGCACAGTTCAGAGAGGAGGG + Intergenic
960921677 3:122753274-122753296 GAGGTACAGGTGAGGGAGGTAGG + Intronic
961363225 3:126381037-126381059 GAGGAATTGGTTAGTGATGTGGG - Intergenic
963247090 3:143073579-143073601 GAGGAACAGGGCAGGGGTTTAGG + Intergenic
963428286 3:145161215-145161237 GAAGGACAGGTCAGAAGTGTTGG + Intergenic
964236773 3:154540167-154540189 AAGGAACAAGTCAGTGATGATGG - Intergenic
964447157 3:156771573-156771595 GAGGAACAGGTTTGAGATGAAGG - Intergenic
966311938 3:178603332-178603354 GAGACACAGGTCAGGGATCTGGG + Intronic
970735357 4:19160817-19160839 GAGGAACAAGTCAGAGAATGGGG + Intergenic
972666417 4:41169262-41169284 AAGGAAGAGGTCAGAGAGGGAGG + Intronic
973319645 4:48797085-48797107 AAGGATGAGGTCAGAGAGGTGGG + Intergenic
973336240 4:48959367-48959389 GAAGAAAAGGACAGAGATGTAGG + Intergenic
974913593 4:68152162-68152184 GAGAAAGAGGTGAGAGATATTGG - Intergenic
978263907 4:106799010-106799032 GATGAACAGGTAAAAGTTGTCGG + Intergenic
978508481 4:109487430-109487452 AAGGGACAGGTGAGAGATGCAGG + Intronic
980296528 4:130925523-130925545 GATGAAAAGCTCAGAGAAGTGGG - Intergenic
981485941 4:145286099-145286121 GAGGATCAGGGCAGAGCTGAAGG + Intergenic
981534113 4:145781611-145781633 GGGGAAGAGGGCAGAAATGTGGG + Intronic
982081483 4:151794329-151794351 GTGGATGAGGTCAGAGAGGTTGG - Intergenic
982661423 4:158211479-158211501 GTGCAACAGGTCAGAGATGCAGG - Exonic
984833423 4:183997599-183997621 AAGGACCAGGTGAGAGATGATGG + Intronic
984892248 4:184504441-184504463 GAGCAGGAGGTCAGAGAAGTAGG + Intergenic
984905755 4:184624485-184624507 CAGAAACAGGTCAGTGATGGAGG - Intergenic
984905759 4:184624515-184624537 CAGAAACAGGTCAGTGATGGAGG - Intergenic
984905763 4:184624545-184624567 CAGAAACAGGTCAGTGATGGAGG - Intergenic
984905767 4:184624575-184624597 CAGAAACAGGTCAGTGATGGAGG - Intergenic
984905771 4:184624605-184624627 CAGAAACAGGTCAGTGATGGAGG - Intergenic
984905775 4:184624635-184624657 CAGAAACAGGTCAGTGATGGAGG - Intergenic
985407913 4:189654502-189654524 CAGGATCAGGGCAGACATGTAGG + Intergenic
985614397 5:910841-910863 GAGGAACAAGGCACAGAGGTTGG - Intronic
986211632 5:5678998-5679020 GAGGCACAGCTGAGAAATGTTGG + Intergenic
986457509 5:7934025-7934047 GAGGAAATGGTCAGATAAGTAGG + Intergenic
988028805 5:25735865-25735887 GATGAAAAGTTCAGAAATGTAGG + Intergenic
990258562 5:53996943-53996965 AAGAAAGAGTTCAGAGATGTGGG + Intronic
990749756 5:59001577-59001599 GTGGAACACTTCAGAGAAGTAGG - Intronic
992229673 5:74651729-74651751 GAGGAAAAGCACAGAGATGCTGG - Intronic
993151368 5:84166687-84166709 GAGGAACAGCAAAGAGATGGTGG + Intronic
994383426 5:99099205-99099227 GAGGAACAGGTGGGAGGTGATGG + Intergenic
995532475 5:113105500-113105522 GAGGAACAGGTTTGAGAAGTAGG - Intronic
996781617 5:127192813-127192835 GAGAAACAGCTGAGAGATGGAGG + Intergenic
999147247 5:149404762-149404784 GGGGTGCAGGTCAGAGATGGTGG - Intergenic
999193541 5:149766595-149766617 CAGGAACAGGACAGATATTTTGG - Intronic
999758524 5:154682854-154682876 GAGGAAAAGGAGAGAGAAGTGGG - Intergenic
1000018757 5:157301061-157301083 GAGGAACAGGGCATAGAGCTGGG + Intronic
1000421290 5:161040767-161040789 GTGGAACAGTACAGAGATGAGGG - Intergenic
1003190914 6:3873740-3873762 GAGGAAAAGGACAGAGAGGAAGG + Intergenic
1003847237 6:10185845-10185867 TGGGAACAGGTTTGAGATGTTGG - Intronic
1003963990 6:11235837-11235859 GAGGATGAGCTCAGAGAGGTAGG + Intronic
1004528380 6:16430234-16430256 GAAGACCAAATCAGAGATGTGGG - Intronic
1004653792 6:17638379-17638401 GAGAAACAGATCACAGATGGTGG - Intronic
1004963089 6:20814565-20814587 GAGAAAAAGGTCAGGCATGTTGG - Intronic
1005434406 6:25792866-25792888 GAGGTTCAAGTGAGAGATGTTGG - Intronic
1005592057 6:27338717-27338739 GAGGAACAGGGCACATATTTGGG - Intergenic
1005825185 6:29628033-29628055 GAGGAGCAGGAGGGAGATGTGGG + Intronic
1006994509 6:38245732-38245754 GTGGAACAGGTAAGTGATGATGG + Intronic
1007258629 6:40546219-40546241 GAGGAACAGCCCAGAGAAGCGGG + Intronic
1008401486 6:51068644-51068666 CAGGAACAGGAGAGAGATGGGGG + Intergenic
1010191939 6:73204610-73204632 GATGACCAAGTCAGAGAGGTAGG - Intergenic
1010331142 6:74625672-74625694 AGGGAAAAGGTCAGAGATATTGG + Intergenic
1011583473 6:88898464-88898486 GAGGAACAAATTAGAGATCTTGG - Intronic
1011861851 6:91767914-91767936 GAAGAAATGGTCAGAGAAGTAGG + Intergenic
1013054495 6:106570309-106570331 TAGGAACAAGACAGATATGTTGG - Exonic
1013070432 6:106724160-106724182 CAGAAACAGGCCAGAGATGATGG + Intergenic
1014271887 6:119345819-119345841 CAGGAACAGGTCAGGCATGGTGG + Intronic
1015051378 6:128844576-128844598 TTGGAACAGGACAGATATGTTGG + Intergenic
1015925579 6:138307348-138307370 CGGGAACAAGTCAGAGATGAAGG + Exonic
1016401783 6:143688972-143688994 GAAGATGAGGTCAGAGAGGTGGG - Intronic
1018104819 6:160475159-160475181 GAAGAACAGGAAAGAGATATTGG - Intergenic
1019713619 7:2528676-2528698 GAGGAACAGGTCTAGGATGCTGG + Intronic
1019888832 7:3928985-3929007 AAGGAACAGGGCAGAGAGTTGGG - Intronic
1019910134 7:4095320-4095342 GAGGAAGAGCTCAGATATGGGGG - Intronic
1020123310 7:5517962-5517984 GAGGAATGGGTCAGAGAGGCTGG - Intergenic
1022135123 7:27439829-27439851 AAAGAAAAGTTCAGAGATGTTGG - Intergenic
1024008567 7:45246521-45246543 CAGGAATACGTCAGAGCTGTGGG - Intergenic
1025916735 7:65872724-65872746 GAAGATCAGGTCATAGGTGTGGG + Intergenic
1026111950 7:67465429-67465451 GAGGAAGTGGTTAGAGATGGTGG + Intergenic
1030295207 7:107918372-107918394 AAAGAAGAGGTCAGAGAAGTAGG - Intronic
1031025480 7:116674714-116674736 GAGGAAGAGGACAGAGAAATGGG - Intronic
1031762188 7:125727465-125727487 GAGGAACAGGGCAGGGTGGTAGG - Intergenic
1033007282 7:137580345-137580367 GGGTAACAGGTCATAAATGTTGG + Intronic
1036943044 8:13069559-13069581 GAGAAACAGGTTTGAGATGAAGG - Intergenic
1037274756 8:17166001-17166023 AGGTGACAGGTCAGAGATGTGGG + Intronic
1037410296 8:18588804-18588826 GAGGGAGAGGACAGTGATGTAGG + Intronic
1037639038 8:20725856-20725878 GAGGAACAGGGCAGAGAATGAGG - Intergenic
1037949065 8:23007114-23007136 GAGGAACAGGTCATAGAACTTGG - Exonic
1038293659 8:26271652-26271674 GAAGAAGAGGTCAGGGATGGAGG + Intergenic
1039101644 8:33947900-33947922 GAGGAATAGGTCACATCTGTGGG - Intergenic
1041038242 8:53817789-53817811 GAGTAGCAGGTCAGAGGTGCAGG - Intronic
1041260871 8:56019578-56019600 GAGGAGAAGGGCAGAGATGCTGG + Intergenic
1041336389 8:56789327-56789349 GAGGGACAGATCAAGGATGTTGG - Intergenic
1043477130 8:80615958-80615980 GAGTCACAGGTCAGAGATGAGGG - Intergenic
1043685256 8:83076584-83076606 AAGGAACAAGACAAAGATGTCGG + Intergenic
1045201058 8:99981923-99981945 GAGGCACAGGTAAGAGATCAGGG - Exonic
1045428573 8:102091939-102091961 GGGGAAAATGTCAGAGGTGTTGG + Intronic
1045595143 8:103646502-103646524 GAGGAACAGCTAACAGATGCTGG - Intronic
1045900636 8:107275405-107275427 GGGGAATAGTTCAGAGATGGGGG - Intronic
1046363469 8:113192584-113192606 GAGAAAAAAGTCAGAGATATAGG - Intronic
1046712700 8:117529406-117529428 AAAGAAGGGGTCAGAGATGTGGG + Intronic
1048591800 8:135827193-135827215 AATGAAGAGGTCAGAAATGTGGG + Intergenic
1048886921 8:138916206-138916228 GAGGAGCAGGGCACAGATGAGGG + Intergenic
1049010488 8:139884130-139884152 GAGGCACAGGACAGAGAAGAGGG - Intronic
1052540869 9:29810454-29810476 TCAGAACATGTCAGAGATGTTGG + Intergenic
1052770016 9:32679099-32679121 GAGGAACAGGTTAGAAACCTAGG - Intergenic
1054910605 9:70451914-70451936 GATGGACTGGGCAGAGATGTTGG + Intergenic
1056315264 9:85382408-85382430 GAGGAAGAGATCTCAGATGTTGG + Intergenic
1057699186 9:97350371-97350393 GAGGAACAGGACAGTGATGGGGG - Intronic
1059328855 9:113522587-113522609 GAGCATTTGGTCAGAGATGTAGG + Intronic
1061569432 9:131467655-131467677 GAGGAAGAGGCCAGAGAGGCTGG + Exonic
1062253612 9:135610649-135610671 ATGGAACAGCTCACAGATGTGGG - Intergenic
1062710804 9:137974208-137974230 CAGGCCCAGGTCAGAGCTGTAGG + Intronic
1203659000 Un_KI270753v1:23927-23949 CAGGATCAGGGCAGACATGTAGG + Intergenic
1187633233 X:21197801-21197823 GAGGTACAGGCCATAGATCTTGG + Intergenic
1190032170 X:46984505-46984527 GACGAACAGGTCAGTCATGAGGG - Intronic
1190117687 X:47636941-47636963 GAGGGAGAGGTCACAGATGGGGG + Intronic
1190340678 X:49292921-49292943 GAGGAGCAGGTCAGGGTTGGTGG + Intronic
1195063100 X:101215624-101215646 GAGGAACAGGTTAAAAATGTAGG - Intergenic
1197161509 X:123327880-123327902 AAGAATCAGGTCAGTGATGTTGG + Intronic
1197194274 X:123682380-123682402 GGAGATGAGGTCAGAGATGTGGG - Intronic
1197532450 X:127646234-127646256 TAGGAAGAGGACAGAAATGTGGG - Intergenic
1197898456 X:131342360-131342382 GAGGAAGAGGGCAGAGAAGGTGG + Intronic
1199506112 X:148563186-148563208 GAGGATGAGGTTAGGGATGTAGG + Intronic
1199720685 X:150541055-150541077 GATGAACAGGTGCCAGATGTAGG - Intergenic
1199804036 X:151280095-151280117 GAGGAAGAGGTTAAAAATGTGGG - Intergenic
1200103208 X:153698627-153698649 GAGGGCCAGGCCGGAGATGTGGG - Intergenic
1200438546 Y:3184173-3184195 GGGGAAAATGTCAGAGGTGTTGG - Intergenic
1201066084 Y:10095735-10095757 GAGGAACAGAATAGAGAGGTTGG - Intergenic