ID: 1132321607

View in Genome Browser
Species Human (GRCh38)
Location 15:100929690-100929712
Sequence GGATTCCTGCCTGAACGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 70}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132321602_1132321607 4 Left 1132321602 15:100929663-100929685 CCACATCTCTGACCTGTTCCTCC 0: 1
1: 0
2: 6
3: 52
4: 531
Right 1132321607 15:100929690-100929712 GGATTCCTGCCTGAACGTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 70
1132321597_1132321607 22 Left 1132321597 15:100929645-100929667 CCCCAGTGATGAGCCAGCCCACA 0: 1
1: 0
2: 0
3: 22
4: 211
Right 1132321607 15:100929690-100929712 GGATTCCTGCCTGAACGTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 70
1132321601_1132321607 5 Left 1132321601 15:100929662-100929684 CCCACATCTCTGACCTGTTCCTC 0: 1
1: 0
2: 0
3: 24
4: 306
Right 1132321607 15:100929690-100929712 GGATTCCTGCCTGAACGTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 70
1132321604_1132321607 -8 Left 1132321604 15:100929675-100929697 CCTGTTCCTCCTGTTGGATTCCT 0: 1
1: 0
2: 3
3: 23
4: 263
Right 1132321607 15:100929690-100929712 GGATTCCTGCCTGAACGTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 70
1132321599_1132321607 20 Left 1132321599 15:100929647-100929669 CCAGTGATGAGCCAGCCCACATC 0: 1
1: 0
2: 1
3: 10
4: 111
Right 1132321607 15:100929690-100929712 GGATTCCTGCCTGAACGTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 70
1132321600_1132321607 9 Left 1132321600 15:100929658-100929680 CCAGCCCACATCTCTGACCTGTT 0: 1
1: 0
2: 0
3: 48
4: 325
Right 1132321607 15:100929690-100929712 GGATTCCTGCCTGAACGTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 70
1132321598_1132321607 21 Left 1132321598 15:100929646-100929668 CCCAGTGATGAGCCAGCCCACAT 0: 1
1: 0
2: 1
3: 15
4: 155
Right 1132321607 15:100929690-100929712 GGATTCCTGCCTGAACGTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132321607 Original CRISPR GGATTCCTGCCTGAACGTGC TGG Intronic
902627211 1:17683540-17683562 GGAGTCCTGCCTGAGCCTCCTGG - Intronic
1066198909 10:33127739-33127761 GGATTCCTGCCCGCCAGTGCAGG - Intergenic
1083397035 11:62399441-62399463 GGCTTCCTGTCTGAAGGAGCTGG - Intergenic
1087171496 11:95053985-95054007 AGACTCCTGCCTGCACATGCAGG - Intergenic
1092083623 12:5738089-5738111 GGTGTGCTGCCTGAAAGTGCTGG - Intronic
1096923890 12:55120430-55120452 GGATACATGTCAGAACGTGCAGG - Intergenic
1098444540 12:70552604-70552626 GGATTCCTGCCTCCACTTGCAGG - Intronic
1098989349 12:77047787-77047809 AGATGCCTGCCGGAAGGTGCTGG + Intronic
1104116071 12:125749837-125749859 AGATTCCTCCCTCAACGTGTGGG - Intergenic
1104859225 12:131916069-131916091 GCAGTCCTGCCGGAACCTGCGGG + Exonic
1106675382 13:31952850-31952872 AGAGACCTGGCTGAACGTGCTGG + Intergenic
1109203085 13:59452691-59452713 GGATACCTGCATGAACAAGCAGG + Intergenic
1112370344 13:98788112-98788134 GGAGTGCTGCCAGGACGTGCTGG - Intergenic
1118925782 14:70188759-70188781 GGATTCCTGCAGGAAGGGGCAGG + Exonic
1123984378 15:25632252-25632274 GGATTCCTTCGGGAAGGTGCAGG + Intergenic
1125598193 15:40900765-40900787 GGAGTTCTGCGTGAACGTGCTGG + Exonic
1125614344 15:40996609-40996631 GGATTCCTGGCTGGGCGTGGTGG - Intronic
1126098244 15:45104302-45104324 GGACTCCTCCCAGAAGGTGCGGG - Exonic
1126105981 15:45147474-45147496 GGACTCCTCCCAGAAGGTGCGGG + Exonic
1129177434 15:73849948-73849970 GGATTCATGCCAGAAAGGGCTGG + Intergenic
1132204724 15:99978419-99978441 GGGTTCCAGTTTGAACGTGCCGG - Intronic
1132321607 15:100929690-100929712 GGATTCCTGCCTGAACGTGCTGG + Intronic
1132680768 16:1140827-1140849 GGCATCCGGCCTGAACGTCCGGG + Intergenic
1137989688 16:53141291-53141313 GGATTCCAGCCTTAACATTCTGG + Intronic
1143514502 17:7413076-7413098 AGATTCCGGCCTGAAAGTGCTGG + Intronic
1144063884 17:11607223-11607245 GGATTCCTGCCTGAGAGTGATGG + Intronic
1146401246 17:32501656-32501678 GGATGCCTCCCGGTACGTGCTGG - Intronic
1148462763 17:47847802-47847824 GGATTCCAGCCTGGACGGGGCGG - Exonic
1148706770 17:49640973-49640995 GAATTCCTGGCTGAGCGTGGTGG + Intronic
1152754524 17:82081721-82081743 GGCGTCCTGCCTGGAGGTGCTGG - Exonic
1154106096 18:11524430-11524452 GGATTGATGCCTGAAAATGCTGG - Intergenic
1155848349 18:30737306-30737328 GGATTTCAGCCTGAATCTGCAGG + Intergenic
1159467960 18:68810723-68810745 GGATACATGGCAGAACGTGCAGG + Intronic
1160195725 18:76753623-76753645 GGATTCCTGGCTGGGCGTGGTGG - Intergenic
1161947061 19:7444004-7444026 GGATCCCAGCCTGAAGGAGCAGG - Intronic
1168187617 19:54709861-54709883 GGGTCCCTGACTGAACCTGCTGG - Intergenic
925159455 2:1673769-1673791 AGATTCCCGCCTAAACTTGCTGG - Exonic
932574496 2:72955288-72955310 GGATTACTGCGTGAACGGGCGGG - Intronic
933426026 2:82113032-82113054 GGTTTCCAGCCTGAACTTCCTGG - Intergenic
935567394 2:104623794-104623816 GGATACATGCATGAACGTGCAGG + Intergenic
938189083 2:129258100-129258122 GGATGCCTGCCTCAACTTGAGGG + Intergenic
944680048 2:202069099-202069121 GGATACATTCCTGAATGTGCTGG + Intergenic
1172942515 20:38664142-38664164 GGGTTCCTGCCTGCACCTGCTGG - Intergenic
1174977878 20:55354869-55354891 GGCTTCCTCCCTGAGCGTGCTGG - Intergenic
1175296599 20:57913111-57913133 GGATTCCTGCCTCCTCTTGCTGG - Intergenic
1178174774 21:30083820-30083842 GGATTCCTGCTTGTAGGAGCAGG + Intergenic
1178524608 21:33316508-33316530 AGATTCCTTCCTGAACATCCTGG + Intergenic
955493635 3:59508262-59508284 GGATTCATGCCTGCATGGGCAGG + Intergenic
955649008 3:61172906-61172928 GGATACCTGCCTGCCCCTGCTGG - Intronic
957035748 3:75290867-75290889 GGAGTTCTGCCTGAAAGTGCTGG + Intergenic
961304286 3:125945845-125945867 GGAGTTCTGCCTGAAAGTGCTGG - Intergenic
969530103 4:7725825-7725847 GGCTTCCTGCCTGGTGGTGCTGG - Intronic
973848480 4:54937220-54937242 GCACTCCAGCCTGGACGTGCAGG + Intergenic
977448134 4:97158134-97158156 GGATTCCTCCCTGTACCTGGAGG - Intergenic
980335940 4:131473588-131473610 GGATACATGGCAGAACGTGCAGG + Intergenic
985688524 5:1294645-1294667 GGTGTCCTGCCTGAAGGAGCTGG - Exonic
989817376 5:45752246-45752268 GGATTCCTCCCTCAACGTGTGGG + Intergenic
992895456 5:81241217-81241239 GGTTTCCTCCCTCCACGTGCTGG - Intronic
993390974 5:87319391-87319413 GGAGTCCTGCCTGGACATCCAGG + Intronic
994560289 5:101361409-101361431 GGATTCCTGTATTAACGTCCTGG + Intergenic
995630519 5:114127303-114127325 AGACTTCTGCCTGAACATGCAGG + Intergenic
995897706 5:117034086-117034108 GGATTTCAGTCTGAATGTGCCGG + Intergenic
997595017 5:135101537-135101559 AGGTTCCTGCCTGCACATGCTGG + Intronic
1002328006 5:178422282-178422304 GGATTCGGGCAAGAACGTGCAGG - Intronic
1006836553 6:37002533-37002555 GGCTTTCTGCCTGTACCTGCAGG - Intergenic
1014922971 6:127234285-127234307 GGATACATGGCAGAACGTGCAGG - Intergenic
1015029768 6:128580630-128580652 GGAGGCCTGGCTGAACATGCCGG - Intergenic
1015992270 6:138958401-138958423 GGATACATGGCAGAACGTGCAGG + Intronic
1018302506 6:162418743-162418765 GGATTCCTTCATGAGTGTGCAGG - Intronic
1027693878 7:81384117-81384139 GAATTCCTGCCTGAGTGTTCAGG - Intergenic
1027695455 7:81404620-81404642 TGATTTCTGCCTGAACATCCAGG + Intergenic
1030265341 7:107615309-107615331 TGATTCCTGGCTGAGCGTGGTGG + Intronic
1040284217 8:46091770-46091792 GAGTTTCTGCCTGCACGTGCTGG - Intergenic
1040544955 8:48391973-48391995 GGTTTCCTGCATTTACGTGCAGG - Intergenic
1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG + Intronic
1049617263 8:143581098-143581120 GGAGGCCCGGCTGAACGTGCTGG - Exonic
1057155724 9:92837323-92837345 GGAGGCCCGGCTGAACGTGCTGG - Intergenic
1057253968 9:93528029-93528051 GGTTTCCTGCCTGAAGGTTTTGG + Intronic
1058651067 9:107176225-107176247 GGATGCCTGCCTGAAGGAGATGG - Intergenic
1060376028 9:123115748-123115770 GGCTTCTTGCTTGAACATGCTGG + Intronic
1062678816 9:137765175-137765197 GAATTCCAGCCTGTACTTGCAGG - Intronic
1193029109 X:76878991-76879013 GGAATTCTGCCTGAACATTCAGG + Intergenic