ID: 1132326687

View in Genome Browser
Species Human (GRCh38)
Location 15:100976200-100976222
Sequence CTAGGTCTACATGGTTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132326683_1132326687 26 Left 1132326683 15:100976151-100976173 CCATGAAGGAAATAAATCAATCA 0: 1
1: 0
2: 3
3: 52
4: 558
Right 1132326687 15:100976200-100976222 CTAGGTCTACATGGTTTTACTGG 0: 1
1: 0
2: 4
3: 39
4: 245
1132326684_1132326687 -4 Left 1132326684 15:100976181-100976203 CCTTCTGACAAAGCAAATTCTAG 0: 1
1: 0
2: 0
3: 32
4: 218
Right 1132326687 15:100976200-100976222 CTAGGTCTACATGGTTTTACTGG 0: 1
1: 0
2: 4
3: 39
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132326687 Original CRISPR CTAGGTCTACATGGTTTTAC TGG Intronic
901361788 1:8707648-8707670 CTTGGTCTGAATGGTTGTACTGG - Intronic
901609620 1:10487408-10487430 CTACGTCCAGATGGCTTTACTGG - Intronic
902647709 1:17813727-17813749 CTAGGTCTAAACGGTTTCACTGG - Intronic
902867960 1:19293075-19293097 CCAGGTCTACATGGCTTCATTGG + Intergenic
903151220 1:21410731-21410753 CCAGGACTACATGGTGTTACTGG - Intergenic
903209398 1:21808295-21808317 CTGGGTTTACAGGGTGTTACAGG + Intergenic
905498012 1:38410652-38410674 CTAGGTCCAGATGGCTTCACTGG + Intergenic
908132286 1:61084762-61084784 CTAGGCCTGCATGGATATACAGG - Intronic
908947112 1:69511743-69511765 CCAGGCCTAGATGGCTTTACTGG + Intergenic
910233912 1:85014801-85014823 CTGGGCCCAGATGGTTTTACGGG - Intronic
910548118 1:88442256-88442278 CCAGGTCCAAATGGTTTCACTGG + Intergenic
910842229 1:91571706-91571728 CTGGGTCTCCAGGGATTTACAGG - Intergenic
913151041 1:116043983-116044005 CTAGGCCCAGATGGCTTTACTGG + Intronic
913599851 1:120412656-120412678 CCAGGTCCAGATGGTTTCACTGG - Intergenic
914087210 1:144464019-144464041 CCAGGTCCAGATGGTTTCACTGG + Intergenic
914192986 1:145426991-145427013 CCAGGTCCAGATGGTTTCACTGG + Intergenic
914311399 1:146470189-146470211 CCAGGTCCAGATGGTTTCACTGG - Intergenic
914591018 1:149105905-149105927 CCAGGTCCAGATGGTTTCACTGG + Intergenic
916139937 1:161687528-161687550 CCAGTCCTAGATGGTTTTACTGG - Intergenic
916603531 1:166317640-166317662 CTAGGTCTAGATAGGTTCACTGG - Intergenic
917177751 1:172256311-172256333 CTAGGGCCAGATGATTTTACAGG - Intronic
918960941 1:191276739-191276761 ACAGGCCTATATGGTTTTACTGG + Intergenic
919095809 1:193034478-193034500 CCAGGCCTACATGGATATACAGG + Intronic
919520244 1:198579826-198579848 TTAGGTCCACATAGTTTTGCTGG - Intergenic
919562704 1:199141698-199141720 CCAGGCCTAGATGGTTTAACTGG + Intergenic
920661209 1:207916768-207916790 CTAGGCCCAAATGATTTTACAGG - Intergenic
1063056916 10:2515153-2515175 CCAGGCCCAGATGGTTTTACTGG + Intergenic
1065163744 10:22952557-22952579 CCAGGTCCAGATGGTTTTACTGG + Intronic
1065365474 10:24931748-24931770 CCATGTCAAGATGGTTTTACTGG + Intronic
1065426377 10:25608572-25608594 CTAGGGTTTTATGGTTTTACGGG - Intergenic
1067304121 10:45043903-45043925 CTAGGTCCAGATGGTTTTAATGG - Intergenic
1067487692 10:46666917-46666939 CTAGGTGTACATGTTGCTACTGG - Intergenic
1067607114 10:47675085-47675107 CTAGGTGTACATGTTGCTACTGG + Intergenic
1071350460 10:84736065-84736087 CTAAGCCTAAATGGTTTCACTGG - Intergenic
1072170268 10:92852254-92852276 CTAGGCCCAGATAGTTTTACTGG + Intronic
1072236325 10:93457137-93457159 CCAGGTCTACATGGAGTTAAGGG + Intronic
1073026563 10:100491292-100491314 CCAGGCCTAGATGGTTTCACTGG + Intronic
1073039348 10:100590949-100590971 TCAGGCCTATATGGTTTTACTGG + Intergenic
1073511915 10:104047792-104047814 CTAGGTGAACAAGGTCTTACTGG - Exonic
1073639192 10:105232149-105232171 CTAGGCTCAGATGGTTTTACTGG - Intronic
1073754324 10:106564936-106564958 CTAGTTCTGCATAGTTTTAGGGG - Intergenic
1073969685 10:109033141-109033163 CTAAGTCTACATGGTTTAATTGG - Intergenic
1074973243 10:118560117-118560139 CTGGGCCTACTTGGTTTTACAGG + Intergenic
1075303217 10:121344053-121344075 CTTGGTCCACATGGGATTACTGG - Intergenic
1075652306 10:124135918-124135940 CAAGGCCCAGATGGTTTTACTGG + Intergenic
1075829579 10:125394959-125394981 CTAGGTCTAGATGCCTTTACTGG - Intergenic
1075869106 10:125755602-125755624 CCAGGTTAAGATGGTTTTACTGG - Intronic
1078472077 11:11597397-11597419 CCAGGTCCAAATGGCTTTACTGG - Intronic
1081565008 11:44254744-44254766 CTATGTCCATATAGTTTTACTGG + Intergenic
1082985262 11:59163565-59163587 CCAGGGCTAGATGCTTTTACTGG + Intergenic
1085647639 11:78237149-78237171 CTATGCCCAGATGGTTTTACTGG - Intronic
1085878356 11:80436087-80436109 CAAGGTCTACATCGTTGAACTGG - Intergenic
1089926591 11:122264488-122264510 TTTGGTCTACAAGGCTTTACAGG - Intergenic
1090987470 11:131782384-131782406 CTAGGTCTGCATGGCTTCACTGG + Intronic
1091830524 12:3546702-3546724 CCAGGCATATATGGTTTTACTGG + Intronic
1091868483 12:3864519-3864541 CTAGGTCCAGATGGTTTCAGTGG - Intronic
1092734812 12:11570957-11570979 CCAGGCCTAGATGGCTTTACTGG - Intergenic
1093190200 12:16065526-16065548 CTGTGTCTCCATGGTTTTGCAGG + Intergenic
1097780144 12:63693191-63693213 CTAGGTCCAGATGGTTTCACTGG - Intergenic
1098468245 12:70813835-70813857 CTTGCTCTACAGGGTTTTCCTGG + Intronic
1099710394 12:86216454-86216476 CTAGATCCAAATTGTTTTACTGG - Intronic
1100357067 12:93841484-93841506 CTAGGCCCAGATGGCTTTACAGG - Intronic
1101887884 12:108683786-108683808 CTAGGCCCAGATGGTTTTACAGG + Intronic
1102384326 12:112494676-112494698 CTGGGTCTACTTGTTTGTACTGG + Intronic
1105401234 13:20097925-20097947 AAAGGACTACATGGTTTTTCTGG - Intergenic
1106988541 13:35386568-35386590 CTAGGTCAACATTATCTTACAGG - Intronic
1107131258 13:36898307-36898329 CCAGGCCCACATGGTTTCACTGG + Intronic
1108946063 13:56025851-56025873 GTAGGTCAAGATGGCTTTACTGG + Intergenic
1109848328 13:68026766-68026788 CTAGGGTTACATGGATTTACAGG - Intergenic
1110018277 13:70436629-70436651 ACAGGTCTAGATGGTTTCACTGG + Intergenic
1110071206 13:71180797-71180819 CTAGGACTTTATGGTTTTACAGG + Intergenic
1111068167 13:83124898-83124920 CTAGGCCCAGATGGTTTTACTGG + Intergenic
1112038613 13:95521761-95521783 CTAGGTCCAGATGGGTTTACTGG - Intronic
1118099915 14:62586355-62586377 CCAGGCCTAGATGGTTTCACTGG - Intergenic
1121040901 14:90746191-90746213 CCAGGTCCAGATGGCTTTACTGG - Intronic
1122764836 14:104060488-104060510 CTAGGCCCAGATGGTTTCACTGG - Intergenic
1122808351 14:104273631-104273653 CTAGGCCCAGATGGTTTCACTGG - Intergenic
1124222095 15:27859553-27859575 CTAGGACCACATGGCTTCACTGG + Intronic
1124385149 15:29201881-29201903 CCAGGTCCAGATGGTTTCACTGG - Intronic
1124553371 15:30703984-30704006 CCAGGCCTAGATGGTTTCACTGG - Intronic
1124677874 15:31701684-31701706 CCAGGCCTAGATGGTTTCACTGG + Intronic
1127323802 15:57874356-57874378 CTATGACCAGATGGTTTTACAGG + Intergenic
1127340277 15:58035065-58035087 CTAAGTCCAGATGGTTTCACTGG - Intronic
1128948868 15:71853475-71853497 CTTGGTCTACTTTGGTTTACAGG - Intronic
1129095241 15:73200144-73200166 CTAGGCCTAGATAGTTTCACTGG - Intronic
1129307579 15:74678469-74678491 CCAGGCCTAGATGGCTTTACTGG + Intronic
1130392338 15:83468937-83468959 CCAGGCCTAGATGGTTTTACTGG - Intronic
1131780499 15:95851985-95852007 CCAGGCCCAAATGGTTTTACTGG + Intergenic
1132326687 15:100976200-100976222 CTAGGTCTACATGGTTTTACTGG + Intronic
1132422408 15:101682744-101682766 CCAGGCCAAGATGGTTTTACTGG - Intronic
1136078456 16:27834530-27834552 CCAGGTCCAGATGGTTTTACTGG - Intronic
1137480503 16:48848535-48848557 CTAGGTCTCCATGCTTTGAGGGG - Intergenic
1138569134 16:57856919-57856941 TTAGGTCCAGATGGTTTTACTGG + Intronic
1140127182 16:72127709-72127731 TTAGGTCTAGATGGTTTTATAGG + Intronic
1142729456 17:1842294-1842316 CTAGGTCCAGATGGCTTTATTGG - Intronic
1142895214 17:2972213-2972235 CTAGATCTAGATGGTCTTGCAGG + Intronic
1142916572 17:3144474-3144496 ATAGGTCCAGATGGTTTCACTGG - Intergenic
1144184368 17:12782943-12782965 CCAGGTCCATATGGTTTTATGGG - Intergenic
1146037612 17:29421521-29421543 CTAGGCCCAGATGGTTTCACAGG - Intronic
1148944496 17:51247837-51247859 CCAGGCCTAGATGGTTTCACAGG - Intronic
1150181140 17:63122294-63122316 CTTGTTCCACATGGTTTTGCAGG - Intronic
1152439127 17:80294661-80294683 CTAGGTCTCCAGGGTTTTGATGG + Intronic
1152692874 17:81728438-81728460 CCAGCTCTAGCTGGTTTTACGGG + Intergenic
1153320341 18:3767280-3767302 CCAGGTCCAGATGGTTTCACAGG + Intronic
1155424512 18:25692403-25692425 CCAGTTCTAGATAGTTTTACAGG - Intergenic
1155856507 18:30840473-30840495 CCAGGACTAGATGGCTTTACTGG - Intergenic
1157460032 18:47882726-47882748 TCAGGCCCACATGGTTTTACTGG - Intronic
1157854083 18:51088086-51088108 TCAGGCCTAGATGGTTTTACTGG + Intergenic
1158330339 18:56355661-56355683 CCAAGTCTACAAGATTTTACTGG + Intergenic
1159822114 18:73158522-73158544 GTAGATCCACATGGTTTTTCCGG - Intronic
1160241393 18:77125954-77125976 CCAGGCCCACATGGTTTCACCGG + Intronic
1160364003 18:78308854-78308876 CAAGCTCTCTATGGTTTTACTGG - Intergenic
1160384916 18:78490417-78490439 CCAGGCATACATGGTTTTACAGG + Intergenic
1164568024 19:29343176-29343198 CTAGGACCAGATGGCTTTACTGG + Intergenic
1164815472 19:31197829-31197851 CCAGCTCTAGATGGCTTTACTGG + Intergenic
1166023935 19:40061851-40061873 CAAAGACTACATGGTTTCACTGG - Intergenic
925699571 2:6621838-6621860 CCAGGTGTAAATGGCTTTACTGG - Intergenic
925750020 2:7079907-7079929 CTAGGCCCAGATGGTTTCACTGG + Intergenic
925957634 2:8983430-8983452 CTAGGCCCAGATGGTTTTACTGG + Intronic
927201058 2:20578306-20578328 CTTGGTCTCCATGGTTTTCAGGG + Intronic
927902824 2:26833639-26833661 CCAGGTCCAGATGGCTTTACTGG + Intergenic
928819970 2:35349614-35349636 GTAGATATACATGGTTTTATTGG - Intergenic
933076241 2:77931016-77931038 CCAGGGCCACATGGTTTCACTGG + Intergenic
935010317 2:99128997-99129019 CTAGGTCTCCCTGGGATTACAGG + Intronic
935153849 2:100464822-100464844 ATAGGTCTACATGTATTCACAGG - Intergenic
935174362 2:100636253-100636275 CTAGGCTCACATGGTTTCACTGG - Intergenic
935566231 2:104610650-104610672 CTAGGCCCAGATGGTTTCACTGG + Intergenic
937330839 2:121027828-121027850 CTAGGTGAAGATGGTTTTGCTGG - Intergenic
938062076 2:128262050-128262072 CTGGGCCCACATGGTTTTGCTGG + Intronic
939448853 2:142346082-142346104 CTAGGCTTAGATGATTTTACTGG + Intergenic
939761344 2:146184719-146184741 CCAGGTCTAGATGGTTTTACAGG - Intergenic
941327266 2:164131708-164131730 CTAAGGCTACATAGTTTCACTGG - Intergenic
941899157 2:170661256-170661278 CTGGGATTACATGGGTTTACAGG + Intergenic
941946055 2:171098513-171098535 CCAGGCCTAGATGGTTTCACTGG + Intronic
942894134 2:181030667-181030689 CCAGGTCCACATAGTTTTACAGG - Intronic
943490386 2:188547078-188547100 CCAGGTGTAGATGGTTTCACTGG + Intronic
944521960 2:200580027-200580049 CTAGGTCCAGATGGTTTCAGAGG - Intronic
946083234 2:217145257-217145279 CTAGCCCCAGATGGTTTTACTGG - Intergenic
946992237 2:225346866-225346888 CTAGGTCGAGATGGCTTCACTGG - Intergenic
947356807 2:229304740-229304762 CCAGGACCAGATGGTTTTACAGG + Intergenic
1169773683 20:9228967-9228989 CTTGGTCTTCATGGTTTGGCAGG + Intronic
1169983555 20:11415449-11415471 CCAGGCCTAGATGGTTTCACTGG - Intergenic
1170340236 20:15318359-15318381 CTAAGACCAGATGGTTTTACTGG + Intronic
1170416886 20:16153168-16153190 CCAGGTCCACATGGTTTTACTGG + Intergenic
1172415244 20:34760593-34760615 ATAGGCCCAGATGGTTTTACAGG - Intronic
1174427501 20:50442812-50442834 CTCTGTCTTCATGGTTTTATGGG + Intergenic
1177796670 21:25785884-25785906 CCAGGGCTAGATGGTTTCACTGG - Intergenic
1178303344 21:31470764-31470786 CTGTTTCTACATGGTTTTCCCGG - Intronic
1180763329 22:18225062-18225084 CCAGGACCAAATGGTTTTACTGG + Intergenic
1180772317 22:18399482-18399504 CCAGGACCAAATGGTTTTACTGG - Intergenic
1180803696 22:18649098-18649120 CCAGGACCAAATGGTTTTACTGG - Intergenic
1180807068 22:18720348-18720370 CCAGGACCAAATGGTTTTACTGG + Intergenic
1181218023 22:21346159-21346181 CCAGGACCAAATGGTTTTACTGG + Intergenic
1181599924 22:23944381-23944403 CCAGGACCAGATGGTTTTACTGG + Intergenic
1181816606 22:25442261-25442283 CCAGGCTTAGATGGTTTTACTGG + Intergenic
1182477159 22:30582554-30582576 CTCGGCCTCCATGGTTTTAGGGG - Intronic
1183794566 22:40105026-40105048 ATATGTCTACATGGTTTTCTAGG + Intronic
1203234157 22_KI270731v1_random:140471-140493 CCAGGACCAAATGGTTTTACTGG - Intergenic
949453097 3:4209094-4209116 CCAGGTCTAGATGTTTTAACTGG - Intronic
949671853 3:6406606-6406628 CTTGGCCTAGATGGTTTCACTGG + Intergenic
950705909 3:14781459-14781481 CCAGGTCCATATGGTTTTACAGG + Intergenic
952141300 3:30481499-30481521 CTAGTTCTACATGTTTGTAGAGG - Intergenic
952564927 3:34643585-34643607 CCAGGTCAAGATGGTTTTATTGG + Intergenic
952951711 3:38531049-38531071 CTGGGTCTACATGGCATGACTGG + Intronic
953831972 3:46306904-46306926 CCAGGTCTATATGGTTTCACTGG - Intergenic
955602718 3:60664585-60664607 CTAGGACTACATTGTTTCACTGG - Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
957342759 3:78922108-78922130 CTAGGTTTACATGGTATTGAAGG + Intronic
957681733 3:83444893-83444915 CTAGGCCCACATGGTTTTGTTGG - Intergenic
959240838 3:103792077-103792099 CTAGGCCCATATTGTTTTACTGG - Intergenic
959290906 3:104472629-104472651 CTAAGGCTAGATGGTTTCACTGG + Intergenic
959536347 3:107489999-107490021 CTAGGTCCAGATGGTTTCACTGG + Intergenic
959846335 3:111038081-111038103 CCATGTCTACGTGTTTTTACAGG - Intergenic
960760368 3:121066821-121066843 CCAGGCCTACATTGCTTTACTGG - Intronic
965646398 3:170886247-170886269 CCAGGTCCAAATGGTTTCACAGG - Intergenic
966630222 3:182064956-182064978 CTAGGTCAATTTGGTCTTACTGG - Intergenic
969833809 4:9821841-9821863 CCAGGTCCACATGGTTTCAGTGG - Intronic
970171206 4:13292229-13292251 CTCGGTTTTCATGGTTTTAGGGG - Intergenic
970336342 4:15048323-15048345 CCAGGCCTAGATGGCTTTACTGG - Intronic
974217466 4:58869180-58869202 CCAGGTCCACATGGTTTTACTGG + Intergenic
975920217 4:79378077-79378099 ATAGGTCTTGATGGTTTTATGGG + Intergenic
977248030 4:94657329-94657351 TTAGCTCTACAGGGATTTACTGG + Intronic
977251761 4:94696162-94696184 CTAGGTCCAGATGGCTTTACCGG - Intergenic
977289958 4:95154416-95154438 TTACTTCTACATGGTTTTAAGGG + Intronic
978206662 4:106088559-106088581 CTGGGTCCAGATGGTTTTTCTGG - Intronic
979420048 4:120493099-120493121 CCAGGTCTAAATGATTTCACTGG - Intergenic
980747893 4:137044289-137044311 CTAGGCCTACTTATTTTTACTGG - Intergenic
982575536 4:157104665-157104687 CTAGGACCAGATGGTTTCACTGG - Intronic
983278001 4:165642289-165642311 CTATGTCTATAAAGTTTTACTGG + Intergenic
983599828 4:169514483-169514505 CTGGGCCTAGATGGTTTCACTGG - Intronic
985223702 4:187735997-187736019 CCAGGTCCAGATGGATTTACTGG + Intergenic
985515209 5:340143-340165 CCAGGTCTAAATGGTTTCACTGG - Intronic
990054507 5:51554925-51554947 CTAAGCCTAGATCGTTTTACTGG + Intergenic
990518994 5:56559408-56559430 TTGGGTTTAAATGGTTTTACTGG - Intronic
992096742 5:73369910-73369932 CTAGGTCTACACAGGTTTAGGGG - Intergenic
992510377 5:77427115-77427137 CTATGGCTACATGGTTCTTCTGG + Exonic
993349369 5:86828927-86828949 TTAGGTCTAGATGGCTTCACAGG - Intergenic
993557467 5:89358723-89358745 CTAGGCCCAGATGGTTTTACTGG + Intergenic
994834082 5:104826991-104827013 CCAGGCCCAGATGGTTTTACAGG - Intergenic
995080389 5:108044744-108044766 CCAGGTCCACATAGTTTCACTGG - Intronic
996116522 5:119626316-119626338 CCATGACTACATGGTTTCACTGG - Intronic
999352389 5:150886509-150886531 CTAGGACTTCATGGATTCACAGG - Intronic
1000061596 5:157661955-157661977 CCAGGCCTCCATGGTTTTATTGG - Intronic
1001808014 5:174605185-174605207 CCAGGACCACATGGTTTCACTGG - Intergenic
1002438416 5:179249780-179249802 CTAGGACCAGATGGCTTTACTGG + Intronic
1002448541 5:179306009-179306031 CCAGGTCTAGACGGTTTTACTGG + Intronic
1007145951 6:39631872-39631894 TTAGGCCTAGATGGTTTCACTGG - Intronic
1009591439 6:65676590-65676612 CTAGGACTAGATGGCTTAACTGG + Intronic
1010347760 6:74832253-74832275 CCAGGTCTAGATGGTTTCATAGG - Intergenic
1010719445 6:79265524-79265546 CCAGGACCAGATGGTTTTACTGG + Intergenic
1010905972 6:81489362-81489384 CTAAATCAACATGGCTTTACTGG - Intergenic
1010941481 6:81923409-81923431 CTAGGCCCAGATGTTTTTACTGG + Intergenic
1013826706 6:114219924-114219946 CAAGGTTTTCATGGTTTTTCTGG - Intronic
1014716942 6:124877236-124877258 CCAGGTCCAAATGGTTTCACTGG - Intergenic
1014722110 6:124929552-124929574 CTAGTTCTACATAGTTGCACTGG - Intergenic
1016125235 6:140393635-140393657 CTAGGTGTGGAGGGTTTTACTGG + Intergenic
1016905194 6:149142086-149142108 CTAAGCCTAAATGGTTCTACAGG + Intergenic
1017258543 6:152361946-152361968 ATGGATCTACATGGTTTTCCTGG + Intronic
1017415583 6:154216961-154216983 CTTGGTTTGCATGGTTTTATGGG - Intronic
1018499265 6:164386824-164386846 CTAAATTTAGATGGTTTTACAGG - Intergenic
1019832056 7:3340893-3340915 CTGGGTCCAGATGGTTTCACTGG + Intronic
1020351488 7:7224426-7224448 CCAGGTCCAGATGGTTTTACTGG - Intronic
1022551339 7:31242356-31242378 ATGGGTCTACATTGTTTTCCAGG + Intergenic
1022938723 7:35209294-35209316 CTAGGTCCAGATGGTTTCACTGG - Intronic
1024203949 7:47136749-47136771 CCAGGTCCATATGGCTTTACTGG - Intergenic
1024405969 7:48980612-48980634 ATAGGTCTATATGAATTTACTGG - Intergenic
1024505356 7:50158034-50158056 CCGGGTGTACAGGGTTTTACTGG - Intronic
1025174186 7:56788929-56788951 CTTGATCTACAGGGATTTACAGG - Intergenic
1025697613 7:63787496-63787518 CTTGATCTACAGGGATTTACAGG + Intergenic
1027689624 7:81327459-81327481 TTAGGACTACATGGCTTCACTGG - Intergenic
1027958018 7:84906823-84906845 CTAGGATTACATCGTTTTTCCGG - Intergenic
1028072213 7:86464623-86464645 CTTGGTACACATGGTTTTATAGG + Intergenic
1029038198 7:97544835-97544857 CCAGGTATAGATGGTTTCACTGG + Intergenic
1030180328 7:106700870-106700892 CCAGGCCTAGATGGGTTTACTGG - Intergenic
1030574029 7:111263795-111263817 CTAGGAGCACATGGCTTTACTGG + Intronic
1031092476 7:117376330-117376352 CCAGGTCCAGATGGTTTCACTGG + Intronic
1032860298 7:135871910-135871932 CCAGGCCCATATGGTTTTACAGG - Intergenic
1033679135 7:143575779-143575801 CTAGGTTTAGATGGTTTCACTGG + Intergenic
1033692702 7:143753675-143753697 CTAGGTTTAGATGGTTTCACTGG - Intergenic
1034363092 7:150519704-150519726 CCAGGTATAGATGGTTTCACAGG - Intronic
1034495458 7:151418719-151418741 CAAGGCCTAGGTGGTTTTACTGG + Intergenic
1035128781 7:156631414-156631436 CTATCTCTACATGTTTTTAAGGG + Intergenic
1038339400 8:26672020-26672042 CTAGGTCCAAATGGTTTCAATGG - Intergenic
1041185191 8:55292265-55292287 CCAGGTCTAAATGGTTTTATTGG - Intronic
1041284864 8:56249874-56249896 TTAGGCACACATGGTTTTACAGG - Intergenic
1041370254 8:57152183-57152205 CTAGGACCAGATAGTTTTACTGG - Intergenic
1041563923 8:59253563-59253585 CTAGGTCTAAATGGGTTCACTGG - Intergenic
1042167279 8:65958133-65958155 CTAGGATTACATGGGATTACAGG + Intergenic
1045364089 8:101459691-101459713 GTAGGTCTGCAAGGCTTTACTGG - Intergenic
1046502045 8:115090548-115090570 CTTGGTCCAAATGGGTTTACTGG - Intergenic
1047245285 8:123137605-123137627 CTTGGTATCCAGGGTTTTACTGG + Intronic
1049561272 8:143311999-143312021 CCAGGCCTAGATGGTTTCACTGG + Intronic
1051019748 9:12528370-12528392 CTAGGTCCAGATGGCTTCACTGG - Intergenic
1051455718 9:17255768-17255790 ATGGGTCTAGATGGTTTCACTGG - Intronic
1051657171 9:19394153-19394175 CTGGGATTACATGGTATTACAGG - Intergenic
1051843571 9:21426220-21426242 CCAGGTCCAGATGGATTTACAGG - Intronic
1053554982 9:39127793-39127815 CTTGGCCCAGATGGTTTTACTGG + Intronic
1054109369 9:61091701-61091723 CTTGGCCCAGATGGTTTTACTGG + Intergenic
1054611488 9:67239424-67239446 CTTGGCCCAGATGGTTTTACTGG - Intergenic
1055378457 9:75678280-75678302 CTGGGTCTAGATGGGTTCACTGG + Intergenic
1056823106 9:89857994-89858016 CTAGGACCTAATGGTTTTACTGG + Intergenic
1057795529 9:98154284-98154306 CTAGGCCTAGATGGTTTTACAGG - Intronic
1058577290 9:106417424-106417446 CCAGATGTCCATGGTTTTACAGG + Intergenic
1059361778 9:113748809-113748831 CTGGGTCCACATGGTTTAAGAGG - Intergenic
1061039852 9:128134290-128134312 CTAGGACCTAATGGTTTTACTGG - Intergenic
1187605512 X:20878121-20878143 CCAGGTCCAGATGGATTTACAGG + Intergenic
1188418899 X:29972543-29972565 CAAGGTCTATATGGTTTTGGGGG + Intergenic
1188500214 X:30817554-30817576 CCAGGACTACATGGCTTTAGTGG + Intergenic
1188766456 X:34098653-34098675 CTAGATCTAGATAGGTTTACTGG + Intergenic
1189579678 X:42392940-42392962 CTAGGGCTAGACGGTTTCACTGG + Intergenic
1189654546 X:43229204-43229226 CTAGGCCTAGACGGTTTCACTGG + Intergenic
1190024137 X:46907254-46907276 CCAGGTCCACATGGTTTCACTGG + Intergenic
1190341007 X:49295730-49295752 CCAGGTCCAGATGGTTTCACTGG - Intronic
1190538298 X:51450777-51450799 CCAGGTCTAGATGGATTTACTGG - Intergenic
1190589544 X:51985614-51985636 ATAGGACCACATGGCTTTACTGG + Intergenic
1191734963 X:64379162-64379184 TTAGGTCCAGATGGTTTCACTGG + Intronic
1192198018 X:69044573-69044595 CTAGGCCCAAATGGTTTCACTGG - Intergenic
1192545937 X:72013927-72013949 CCAGGTCCAGATGGTTTCACTGG - Intergenic
1192749416 X:73973234-73973256 GTAGGCCTACATGGTTTCAATGG - Intergenic
1194488727 X:94519780-94519802 CTAGGACTAGATGGTTTCACGGG + Intergenic
1195406341 X:104518230-104518252 CCAGGCCTAAATGGTTTTACTGG - Intergenic
1196072200 X:111538611-111538633 CCAGGTCTATATGGCTTCACTGG + Intergenic
1196249489 X:113443479-113443501 CTATGCCTATATGGCTTTACTGG + Intergenic
1196362314 X:114877055-114877077 CCAAGACTACATGGTGTTACTGG - Intronic
1196526567 X:116734822-116734844 TCAGGTCTACAGGGTTTTATGGG - Intergenic
1196535788 X:116841927-116841949 CTAGGCCCAGATGGTTTCACTGG - Intergenic
1196930614 X:120677702-120677724 CTAGGTCCAAGTGGTTTCACTGG - Intergenic
1197435059 X:126417512-126417534 CTTGGACTAAATGGGTTTACAGG - Intergenic
1199431798 X:147770011-147770033 TCAGGTCCAGATGGTTTTACTGG - Intergenic