ID: 1132327622

View in Genome Browser
Species Human (GRCh38)
Location 15:100984938-100984960
Sequence ACGTGGGCCCTTCTAGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132327622 Original CRISPR ACGTGGGCCCTTCTAGGTGC AGG (reversed) Intronic
900421285 1:2557018-2557040 ATGTGGGCACTTCTGGGGGCTGG + Intronic
900929566 1:5727922-5727944 ATGTGGGCCCTTGGAAGTGCAGG - Intergenic
900980451 1:6043314-6043336 ACTTGGCCCCTCCTAGGGGCAGG - Intronic
901319928 1:8333682-8333704 ACCTGTGCCTTTCAAGGTGCTGG + Intronic
902631433 1:17706894-17706916 TCGTGGGCCCTTCCAGGTGCCGG + Intergenic
903060816 1:20667362-20667384 ACATGGGACCGTCTAGTTGCAGG + Intronic
906740778 1:48181748-48181770 AGGTGGGACCATCTAGTTGCAGG - Intergenic
910228755 1:84964676-84964698 AGATGGGACCTTCTAGTTGCAGG - Intronic
912337953 1:108880343-108880365 ACCTGGGCCCCTCAAAGTGCTGG - Intronic
914987526 1:152473108-152473130 ATATGGGGCCTTCTAAGTGCCGG - Intergenic
916455729 1:164969507-164969529 AGGTCTGCCCTTCTAGGTGAGGG + Intergenic
918407231 1:184223193-184223215 AGATGGGACCTTCTAGTTGCAGG - Intergenic
918779786 1:188684710-188684732 AGATGGGACCTTCTAGTTGCTGG - Intergenic
922877851 1:228954458-228954480 ATGTGGCCCCTCCCAGGTGCTGG + Intergenic
1064269479 10:13851949-13851971 ATGTGGGACCATCTAGTTGCAGG + Intronic
1065253850 10:23844893-23844915 ACCTGGGCCTGTCGAGGTGCGGG - Intronic
1065931566 10:30483823-30483845 ACATGGGGCCGTCTAGTTGCAGG + Intergenic
1066221074 10:33336352-33336374 ACGTGCGCCCCTCGGGGTGCAGG + Intergenic
1067148844 10:43713060-43713082 TGGTGTGCCCTTCTTGGTGCAGG + Intergenic
1067284809 10:44899782-44899804 ATGTGGGCCCTTCGAGAAGCTGG + Intergenic
1067792783 10:49300558-49300580 AAGTGGGCCCTGGAAGGTGCAGG - Intronic
1072723465 10:97796046-97796068 GAGTGGGCCCTCCCAGGTGCAGG - Intergenic
1073247940 10:102104925-102104947 ACTAGGCCCATTCTAGGTGCTGG - Intergenic
1073598080 10:104819612-104819634 ACTTGGACCCTTCCATGTGCTGG + Intronic
1073715893 10:106106957-106106979 AGATGGGACCATCTAGGTGCAGG + Intergenic
1077131936 11:977363-977385 ACGGGGGCCCTTCCTGGGGCTGG + Intronic
1079405930 11:20145714-20145736 ACGTGGCCCCTCCCAAGTGCTGG - Intergenic
1081160341 11:39741198-39741220 ATGTGGCCCCTCCCAGGTGCTGG - Intergenic
1081181892 11:39994109-39994131 ACCTTGGCCCTTCAAAGTGCTGG - Intergenic
1082616813 11:55371188-55371210 ACTGTGACCCTTCTAGGTGCAGG + Intergenic
1082769915 11:57199842-57199864 AGGTGGGACCCTCTAGTTGCAGG + Intergenic
1083324537 11:61866636-61866658 ACGTGGGCCCTGCAGGCTGCAGG + Exonic
1083650046 11:64197762-64197784 ATGCGGGCCTTTCTAGCTGCAGG + Intronic
1084136566 11:67187821-67187843 ACCTGGGCCTTCCAAGGTGCTGG + Intronic
1089822611 11:121241737-121241759 ACGGGGGTCCTCCCAGGTGCAGG - Intergenic
1090169940 11:124592360-124592382 ACGTCGGCCTTTCAAAGTGCTGG + Intergenic
1090652984 11:128823562-128823584 GCGGGCGTCCTTCTAGGTGCTGG - Intergenic
1092755342 12:11758068-11758090 AGGGGTGCCCTTCTAGGAGCAGG + Intronic
1094014749 12:25850431-25850453 ACCTGGGCCCCTCAAAGTGCTGG - Intergenic
1094053896 12:26249247-26249269 AGGTGGGACCATCTAGTTGCAGG - Intronic
1099198620 12:79649535-79649557 GCGTGGGCCTCTCAAGGTGCTGG - Intronic
1100135922 12:91553314-91553336 ATGTGGCCCCTCCTAAGTGCTGG + Intergenic
1100230857 12:92605531-92605553 ACATGGGGCCATCTAGTTGCAGG + Intergenic
1101955913 12:109212455-109212477 AGATGGGACCTTCTAGGTGCAGG - Intronic
1102694369 12:114786705-114786727 CCAGGGGCCATTCTAGGTGCTGG + Intergenic
1104257356 12:127151419-127151441 AAATGGGACCATCTAGGTGCAGG - Intergenic
1105291384 13:19055860-19055882 AGGTGGGCACTTGTGGGTGCAGG - Intergenic
1110778797 13:79440926-79440948 AGATGGGACCATCTAGGTGCAGG - Intergenic
1111127392 13:83929267-83929289 ATGTGGCCTCTTCCAGGTGCTGG + Intergenic
1111200179 13:84926795-84926817 AGATGGGACCTTCTAGTTGCAGG - Intergenic
1111592655 13:90370128-90370150 AGATGGGACCTTCTAGTTGCAGG - Intergenic
1115345180 14:32335239-32335261 GTGTGGGCCCTTCTCAGTGCAGG - Intronic
1118046229 14:61974357-61974379 ACAAGGGCCCTTCTAAGTGTAGG - Intergenic
1122321529 14:100858679-100858701 ACGTGGGTGCTTCTGGGAGCAGG - Intergenic
1122633351 14:103118274-103118296 ACATGGGCCCTTCTCGGAGCCGG - Intergenic
1127142263 15:55990089-55990111 ACTTGGGACCATCTAGTTGCAGG + Intronic
1129836432 15:78710361-78710383 ACGTGGGACCTTATTGGTCCTGG + Intronic
1130228315 15:82076798-82076820 ACTTGAGCCCTTCCAGGTGGTGG + Intergenic
1130893741 15:88154364-88154386 TCATGGGCCCTCCTTGGTGCTGG - Intronic
1132327622 15:100984938-100984960 ACGTGGGCCCTTCTAGGTGCAGG - Intronic
1133555666 16:6904349-6904371 ACCTGGGCCTTCCAAGGTGCTGG - Intronic
1133902113 16:9986513-9986535 ACCTTGGCCCCTCAAGGTGCTGG - Intronic
1134467382 16:14491512-14491534 ACCTGGGCCTCTCAAGGTGCAGG - Intronic
1134657908 16:15961093-15961115 ACCTTGGCCCTTCCATGTGCTGG + Intronic
1138313724 16:56050362-56050384 AGGTGGGACCATCTAGTTGCAGG + Intergenic
1140350872 16:74261003-74261025 ACGTGGGGCCTCATGGGTGCTGG - Intergenic
1140563033 16:76006439-76006461 GCGTTGGCCCCTCAAGGTGCTGG + Intergenic
1143822630 17:9577004-9577026 ATTTGGTCCCTTTTAGGTGCTGG - Intronic
1145077246 17:19866825-19866847 ACGGGGGCTCTTCGGGGTGCAGG + Intronic
1145237675 17:21220567-21220589 ACCTTGGCCCCTCAAGGTGCTGG + Intergenic
1146806949 17:35872259-35872281 ATCTGGGCCCTTCAAGGAGCGGG + Exonic
1147506122 17:41019303-41019325 AGGTGGGACCATCTAGTTGCAGG - Intronic
1147652659 17:42071249-42071271 CCCTGGGGCCTTCTGGGTGCTGG + Intergenic
1149360425 17:55889277-55889299 ACATGGGACCATCTAGTTGCAGG + Intergenic
1149459255 17:56813694-56813716 ACCTGGTACCTGCTAGGTGCCGG - Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1150297804 17:64023143-64023165 ACGTGGGCCCTTCAAAGCTCTGG - Intergenic
1150468348 17:65414620-65414642 ACATGGGCCCCTCTGAGTGCTGG + Intergenic
1150983253 17:70168208-70168230 ACGTGGCCCCTAGGAGGTGCTGG - Intergenic
1152910345 17:83001616-83001638 ACGGGAGCCCCTCTAGGTGCTGG + Intronic
1152977828 18:240859-240881 AGATGGGACCTTCTAGTTGCAGG - Intronic
1156009612 18:32481437-32481459 AGGTGGGACCATCTAGTTGCAGG - Intergenic
1156476195 18:37406892-37406914 AGGTGGGCCTGTCTAGGAGCGGG + Intronic
1157730163 18:49997014-49997036 ACCTAGGCCTTTCTAAGTGCTGG - Intronic
1160412135 18:78682276-78682298 AGATGGGACCGTCTAGGTGCAGG + Intergenic
1160430795 18:78811354-78811376 AGATGGGACCGTCTAGGTGCAGG - Intergenic
1161793954 19:6375935-6375957 ACGTGGGGCCTCCTGGCTGCAGG - Intronic
1161953804 19:7482083-7482105 ACGTGGACTCTTCTCGGTGGTGG - Exonic
1162543840 19:11315864-11315886 ACCTGGGCCCATCTGGCTGCTGG + Intronic
1163784821 19:19269614-19269636 ATGGGGGTGCTTCTAGGTGCAGG + Intronic
1166891693 19:45998071-45998093 CCATGTGCTCTTCTAGGTGCTGG - Intronic
1167539103 19:50074161-50074183 ACTTGGGCCCTCCTGGCTGCTGG + Intergenic
1168190061 19:54731705-54731727 ACGTGGGAGCCTCTAGGAGCTGG - Intronic
925439464 2:3871916-3871938 AGATGGGACCTTCTAGTTGCAGG - Intergenic
927204427 2:20598245-20598267 AGGTGGGACCATCTAGTTGCAGG - Intronic
929100820 2:38311703-38311725 AGGTGAGTGCTTCTAGGTGCTGG + Intronic
930771683 2:55136302-55136324 ACACGGCCCCTTCCAGGTGCTGG + Intergenic
933595928 2:84283296-84283318 ACAAGGGCCTTTCTAGGTGTTGG + Intergenic
933891288 2:86772931-86772953 ATGTGGGCCGTTCTTGGTGTGGG + Intronic
935870962 2:107449410-107449432 AGGTGGGACCCTCTAGTTGCAGG - Intergenic
937615113 2:123912696-123912718 ACGTGCACCTTTCTATGTGCGGG + Intergenic
938779578 2:134573244-134573266 ACTTGGGTTCTTCTAGTTGCTGG - Intronic
941509022 2:166382855-166382877 AGATGGGACCTTCTAGTTGCAGG + Intergenic
942209546 2:173656850-173656872 ACCTTTGCTCTTCTAGGTGCTGG - Intergenic
944440418 2:199737700-199737722 GTGTGGGGCCTTCTAAGTGCGGG - Intergenic
944917268 2:204373898-204373920 ACGTGGGAACATCTAGTTGCAGG - Intergenic
948663307 2:239519897-239519919 TCATGGGCCCTTCCAGGTGACGG - Intergenic
948955844 2:241290359-241290381 ACCTTGGCCTTTCAAGGTGCTGG - Intronic
1169356792 20:4913327-4913349 ACATTTCCCCTTCTAGGTGCAGG - Intronic
1170356507 20:15497537-15497559 ACCTCGGCCCTTCAAAGTGCTGG + Intronic
1172678547 20:36693770-36693792 ACATGGGACCATCTAGTTGCAGG + Intronic
1174555538 20:51392793-51392815 AGCTGGGCCCTTCTAGGTTCAGG + Intronic
1174733529 20:52941511-52941533 ACCTGGGCCCCTCAAAGTGCTGG + Intergenic
1174942003 20:54939733-54939755 ACCTGTGCCCTTCTTGTTGCTGG + Intergenic
1175246219 20:57583708-57583730 ATGTGGGCCCCTCAAGGTGGGGG + Intergenic
1175461163 20:59152869-59152891 ACATGGGCCCTGCTAGGTGGAGG + Intergenic
1175495350 20:59410681-59410703 ACGTGGGCCCTTCCAGAAGAGGG - Intergenic
1176430704 21:6573832-6573854 CCTTGGGCCCTGCTAGGCGCGGG + Intergenic
1178588690 21:33891212-33891234 AAGAGGGACTTTCTAGGTGCAGG + Exonic
1179706098 21:43181294-43181316 CCTTGGGCCCTGCTAGGCGCGGG + Intergenic
1182396934 22:30042970-30042992 AGGTGGGCCCTTCTGAGTGTGGG - Intergenic
1184247494 22:43243061-43243083 TCGTGGGCCCTTCTAAGGGCGGG + Intronic
1184469055 22:44685190-44685212 ACGGAGGCCCTACTGGGTGCTGG - Intronic
950160029 3:10753465-10753487 ACGGAGGCTCTTCTATGTGCCGG - Intergenic
950907872 3:16555426-16555448 ATGTGGCCCCTCCTAAGTGCTGG + Intergenic
951923850 3:27886048-27886070 ATGTGGGACATTCTAGGAGCAGG - Intergenic
953154852 3:40360407-40360429 GCCTTGGCCCTTCAAGGTGCTGG - Intergenic
955728042 3:61953465-61953487 ACGTGAGCACTTCTGGATGCCGG + Intronic
961171820 3:124802574-124802596 GCGTGGGCCCTTCTGAGTGGGGG - Intronic
961328211 3:126124178-126124200 ACGAAAGCCCTTCCAGGTGCAGG + Intronic
961490638 3:127254832-127254854 GCGTGGGCTCTTCTGGGTACAGG - Intergenic
963684868 3:148420485-148420507 ATGTGGCCCCTCCTAAGTGCTGG - Intergenic
964035767 3:152194794-152194816 GAGTGTGCCCTTCTAAGTGCAGG + Intergenic
966718817 3:183040459-183040481 ACCTTGGCCTTTCAAGGTGCTGG - Intronic
967302198 3:188025760-188025782 ACATCGGTCCTTCGAGGTGCTGG - Intergenic
968625309 4:1624246-1624268 CCGTGGGCCCTGCGAAGTGCTGG - Intronic
969197396 4:5573841-5573863 CCGTGGGCCTTGCTAGCTGCAGG - Intronic
970955572 4:21807012-21807034 AGGTGGGACCATCTAGTTGCAGG - Intronic
972967076 4:44523854-44523876 ATATGGGCCCTTCTAGAAGCTGG + Intergenic
974006360 4:56560993-56561015 ACCTGGGCCTTTCAAAGTGCTGG + Intronic
974364001 4:60921851-60921873 ACATGGGACCGTCTAGTTGCAGG - Intergenic
980785552 4:137549775-137549797 ACCTGGGCCTTTCAAAGTGCTGG - Intergenic
982237290 4:153263529-153263551 ACCAGGACACTTCTAGGTGCTGG + Intronic
984086957 4:175325386-175325408 ATGTGGCCCCTCCTAAGTGCGGG + Intergenic
984788026 4:183587197-183587219 ACATGGGACCGTCTAGTTGCAGG + Intergenic
985241849 4:187938347-187938369 ACCTCGGCCTTTCAAGGTGCTGG + Intergenic
986306833 5:6522516-6522538 TTGTGGGCCCTGCTGGGTGCAGG - Intergenic
986339234 5:6775332-6775354 ACAAGGGCCCCTCTAGGTGAAGG - Intergenic
986352632 5:6894562-6894584 GCCTGGGGCCTTCTAAGTGCAGG + Intergenic
986516891 5:8573750-8573772 ACGGGAGCTCTACTAGGTGCTGG + Intergenic
993181711 5:84561945-84561967 ATGTGGCCCCTTCCAAGTGCTGG - Intergenic
997065741 5:130556583-130556605 ATGTGGCCCCTCCTAGGTGCTGG + Intergenic
998419087 5:141967538-141967560 TCTGGGGCCCTTCTAAGTGCAGG + Intronic
1000770433 5:165346808-165346830 ACCTTGGCCCCTCAAGGTGCTGG - Intergenic
1002759757 6:192319-192341 GCGTGGGCCCTTCTGAGTGCAGG + Intergenic
1004327238 6:14686506-14686528 ACATGGGACCATCTAGTTGCAGG - Intergenic
1005568897 6:27125446-27125468 TCTTGGGTCCTTCTAAGTGCAGG + Intergenic
1006454369 6:34123482-34123504 ACGTGCACCTTTCCAGGTGCAGG - Intronic
1008937364 6:57006322-57006344 ATGTGGGCCCTTCTAAGAGCAGG - Intronic
1009746267 6:67820650-67820672 AGGTGGCCCCTTCTAAGTGCTGG - Intergenic
1011234385 6:85200108-85200130 AAATGGGACCTTCTAGTTGCAGG - Intergenic
1012791074 6:103696586-103696608 CCATGGGCCCTTCCAGGTGCTGG + Intergenic
1018003440 6:159599476-159599498 ACGTGAGGCCTTGTTGGTGCTGG + Intergenic
1019389356 7:777060-777082 ACATGGGACCGTCTAGTTGCAGG + Intronic
1019464666 7:1181130-1181152 ACGTGGGGCTTTGGAGGTGCGGG - Intergenic
1020848333 7:13316082-13316104 ACATGGGACCATCTAGTTGCAGG - Intergenic
1023326993 7:39071160-39071182 AGATGGGACCTTCTAGTTGCAGG - Intronic
1024493690 7:50017182-50017204 AGATGGGACCTTCTAGTTGCAGG - Intronic
1026260621 7:68752230-68752252 AAGTGGGACCATCTAGTTGCAGG + Intergenic
1026269021 7:68820379-68820401 AGATGGGACCTTCTAGTTGCAGG - Intergenic
1026520034 7:71109351-71109373 ACGTGACGCCTTCTTGGTGCAGG - Intergenic
1026626858 7:72001459-72001481 ATGTGGCCTCTCCTAGGTGCTGG + Intronic
1027526835 7:79279552-79279574 ACTTGGGCCTTTCAAAGTGCTGG - Intronic
1029627911 7:101731936-101731958 AAGTGGTCCCTCCCAGGTGCAGG - Intergenic
1030887122 7:114951976-114951998 ACGGGGGTCCTTCTAAGTGCTGG + Intronic
1030939536 7:115629204-115629226 AAGTGGGACCATCTAGTTGCAGG + Intergenic
1034421944 7:150995224-150995246 ACTTGGGCCCCTCTGGGGGCTGG - Exonic
1035229439 7:157455096-157455118 ACCTTGGCCCTTCAAAGTGCTGG + Intergenic
1035412095 7:158653117-158653139 ACCTTGGCCTTTCAAGGTGCTGG - Intronic
1035452297 7:158985263-158985285 ACGTGGGCCCTTCAGGATGAAGG + Intergenic
1037923309 8:22824641-22824663 ACATGGGACCCTCTAGTTGCAGG - Intronic
1038476236 8:27870476-27870498 ACCTGGGCCCCTCCAGGTGTAGG - Exonic
1040899599 8:52404328-52404350 ACCTGAGCCCTTCTCTGTGCAGG - Intronic
1041467614 8:58172798-58172820 ATATGGGCCCTTCTAGGGGAGGG - Intronic
1044658238 8:94570680-94570702 GCCTGGGCCCCTCAAGGTGCTGG - Intergenic
1047461233 8:125067265-125067287 ACGTGGGCCTTCCAAGGTGCTGG + Intronic
1048509268 8:135047582-135047604 ACCTGGGCCTTTCAAAGTGCTGG + Intergenic
1050182011 9:2933215-2933237 CCGGGGGCGCTCCTAGGTGCAGG - Intergenic
1051536407 9:18163457-18163479 ATGGGGACCCATCTAGGTGCTGG + Intergenic
1054978603 9:71177198-71177220 AGATGGGACCTTCTAGTTGCAGG + Intronic
1057108787 9:92447309-92447331 AGGTGGGACCATCTAGTTGCAGG - Intronic
1058754377 9:108070811-108070833 ACATGGGACCATCTAGTTGCAGG - Intergenic
1187693243 X:21893123-21893145 ACGGGGGACCATCTAGTTGCAGG - Intergenic
1190075188 X:47311914-47311936 ATGTGGCCCCTTCTAGGTGCTGG - Intergenic
1195025812 X:100876452-100876474 ACGTGGGCCTCTCAAAGTGCTGG + Intergenic
1195761271 X:108249001-108249023 ACATGGGACCATCTAGTTGCAGG + Intronic
1196107159 X:111909032-111909054 ACCTGGGCCCCTCAAAGTGCTGG - Intronic
1202274187 Y:23098681-23098703 ACGTGGCCCCTCCTAAGTGCTGG + Intergenic
1202291839 Y:23321996-23322018 ACGTGGCCCCTCCTAAGTGCTGG - Intergenic
1202427183 Y:24732426-24732448 ACGTGGCCCCTCCTAAGTGCTGG + Intergenic
1202443608 Y:24937668-24937690 ACGTGGCCCCTCCTAAGTGCTGG - Intergenic