ID: 1132329292

View in Genome Browser
Species Human (GRCh38)
Location 15:101000562-101000584
Sequence TCTCCTGGAAGCCCTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 1, 2: 4, 3: 54, 4: 332}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132329282_1132329292 22 Left 1132329282 15:101000517-101000539 CCTGGAGGTCAGCAGTCCACGGT 0: 1
1: 0
2: 2
3: 17
4: 157
Right 1132329292 15:101000562-101000584 TCTCCTGGAAGCCCTGAGGGAGG 0: 1
1: 1
2: 4
3: 54
4: 332
1132329286_1132329292 6 Left 1132329286 15:101000533-101000555 CCACGGTCAAGGTGTTGGAAGGG 0: 1
1: 0
2: 18
3: 163
4: 712
Right 1132329292 15:101000562-101000584 TCTCCTGGAAGCCCTGAGGGAGG 0: 1
1: 1
2: 4
3: 54
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132329292 Original CRISPR TCTCCTGGAAGCCCTGAGGG AGG Intronic
900229974 1:1551784-1551806 TCGCCCCGAAGGCCTGAGGGAGG + Intronic
900455088 1:2770385-2770407 TCACCTGGAAGCAGTGGGGGGGG - Intronic
900744672 1:4352912-4352934 GCTCCTGGAAGCTCTGATGATGG - Intergenic
901215635 1:7553610-7553632 TTTCCTGGAGGCCCAGATGGGGG + Intronic
901388107 1:8924445-8924467 TATCCCTGAAGCCTTGAGGGAGG - Intergenic
902181969 1:14696327-14696349 TCCCCTGGATGCCCTCAGGCTGG - Intronic
902229957 1:15021582-15021604 TCACCTGGAAGCCAGGAGGGCGG - Intronic
902386160 1:16077072-16077094 TGCCCTGGCAGCCCTGGGGGTGG + Intergenic
902832757 1:19028384-19028406 CCTCCTGGGAGCCCAGACGGTGG + Intergenic
903331109 1:22597657-22597679 TCTCCTGCAGGCCCCGAGAGGGG - Exonic
903770269 1:25759394-25759416 TCCCCAGGCAGCCCTCAGGGAGG - Intronic
903846856 1:26283981-26284003 TCTCCTGGAAACTGTGAGGCTGG - Intronic
904260264 1:29283921-29283943 TCTCCTGGAGGCACAGATGGGGG - Exonic
904312350 1:29637018-29637040 CCTCCTGGAGGCTCTGAGGGAGG + Intergenic
904784230 1:32973393-32973415 TCTGCTGGAAGCCCAGTGAGAGG - Intergenic
905203208 1:36327792-36327814 GCTCCTGGAGGCCCTGGGGAAGG + Exonic
905683615 1:39892733-39892755 TCTACTGTAAGCCCAGTGGGCGG - Intergenic
906343718 1:45002602-45002624 TGTCACGGAGGCCCTGAGGGAGG + Exonic
907091560 1:51729940-51729962 TCCCCTGGAGGCACAGAGGGCGG + Intronic
912435948 1:109661155-109661177 TCTTCTCCAAGCCCTGAGAGGGG - Exonic
912437890 1:109674737-109674759 TCTTCTCCAAGCCCTGAGAGGGG - Exonic
912440401 1:109693196-109693218 TCTTCTCCAAGCCCTGAGAGGGG - Exonic
912443694 1:109717327-109717349 TCTTCTTCAAACCCTGAGGGCGG - Exonic
912933024 1:113981221-113981243 CCTCCTGGAAGACCTGGTGGAGG + Exonic
912945913 1:114083960-114083982 TCTCCTGGAAGGGATGAGGCTGG + Intergenic
914943728 1:152045454-152045476 GCTCTTGGAAGGCCTGAGGATGG + Intronic
915405342 1:155655957-155655979 TATCCTGAAAGCCCTGAGGGAGG + Intergenic
916894738 1:169151128-169151150 TCTCCTGGAAGCCCTGGGGTGGG - Intronic
917611405 1:176692534-176692556 TCTCCAGGCCTCCCTGAGGGGGG - Intronic
917682898 1:177385734-177385756 TTTCCTGGATGTCCTGAGGCTGG + Intergenic
919751297 1:201039854-201039876 TCTCCTGGGAGCCCTGGTGTTGG + Exonic
922216478 1:223524065-223524087 TCTCATGGAACCCAAGAGGGAGG - Intergenic
922460668 1:225812407-225812429 TCTTCAGGAAGCCCTGAATGAGG + Intronic
922500925 1:226096386-226096408 TGTCCTTGAAGCACTGAGGCTGG - Intergenic
922883046 1:228997064-228997086 ACTCCTGGAGCCCCTCAGGGCGG + Intergenic
923242261 1:232097364-232097386 TCTACTGGCTGCCCTGGGGGAGG + Intergenic
924289564 1:242524219-242524241 TCTGCTCGAAGCCCTCATGGGGG + Exonic
924384137 1:243487270-243487292 TCTCCTGCAAGGCCCCAGGGGGG - Intronic
1062931420 10:1355015-1355037 CCTCGTGGGAGCCCTCAGGGAGG - Intronic
1063029262 10:2215229-2215251 TCTCCTGAAAGCCATGAGGAGGG + Intergenic
1063060626 10:2547744-2547766 TCTACAGGAAGCCAGGAGGGTGG - Intergenic
1065283494 10:24164763-24164785 CCACCTAGAATCCCTGAGGGGGG - Intronic
1067136110 10:43608566-43608588 CATCCGGGAACCCCTGAGGGAGG - Intronic
1068566589 10:58582687-58582709 CCTTCTAGAAGCCCTGGGGGAGG + Intronic
1069513022 10:69056345-69056367 TCCCATGGCAGCCCTGGGGGAGG + Intergenic
1069604161 10:69729386-69729408 TGTTCTGGAAGTCCTGTGGGAGG + Intergenic
1069604738 10:69732084-69732106 ATGCCTGGAGGCCCTGAGGGAGG + Intergenic
1069636129 10:69925983-69926005 TCTCCTGGAAGCGCTGCCTGAGG - Intronic
1069861459 10:71474209-71474231 CCTCCAGGGAGCCCTCAGGGTGG + Intronic
1069940812 10:71954104-71954126 TATCCCTGAAGCCCTGAGGAAGG + Intergenic
1069943837 10:71972840-71972862 TCTCCTGGAAGCCTGGGTGGTGG + Intronic
1070633983 10:78109133-78109155 TGTCCTGGAAGCAAGGAGGGTGG + Intergenic
1073514431 10:104064330-104064352 TCTCCAGGAGGCCCTGAGGATGG + Intronic
1076326105 10:129624246-129624268 TTTCCTGGCAGCCCTGGGGATGG + Intronic
1076451612 10:130560584-130560606 CCTCCTGGTAGCTCTGAGTGGGG + Intergenic
1076504978 10:130965739-130965761 TCTCCTGCAAACTGTGAGGGTGG + Intergenic
1076586656 10:131553296-131553318 TCCACAGGAAGCCCGGAGGGTGG + Intergenic
1076784760 10:132744320-132744342 CCTCCTGGGAGGCCTGTGGGTGG - Intronic
1077095091 11:795814-795836 ACCCCTGGAAGCCTTGGGGGTGG + Intronic
1077541474 11:3148431-3148453 CCTGCTGGCAGCCCTGAAGGCGG + Intronic
1077572930 11:3354978-3355000 TATCCTGGAAGCCCTGAGGGAGG + Intronic
1078020070 11:7649675-7649697 TCTCCAGGTAGCCCTGAGCCAGG + Intronic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1081621008 11:44619160-44619182 ACCCCTGGGAGCCCTGAGGTTGG - Exonic
1081634796 11:44714000-44714022 TTTACAGGAAGCCCTGAGTGAGG + Intergenic
1081726547 11:45333826-45333848 TTTCCCGGAAGCCCTGCAGGAGG + Intergenic
1082756348 11:57080330-57080352 TCCCCTTGATGCCCTGAGTGTGG + Intergenic
1083458078 11:62792079-62792101 TCTCCTCCCAGCCCTGAGCGAGG - Intergenic
1083778466 11:64906181-64906203 TCACCAGGAACTCCTGAGGGTGG + Exonic
1083962661 11:66022963-66022985 TTTCCCGGAAGCCCTGAATGAGG + Exonic
1084416113 11:69033810-69033832 TCACCTCAAAGCCCTGAGGTGGG + Intergenic
1085413048 11:76302852-76302874 TCTCCAGCAGGCCCTGGGGGAGG + Intergenic
1085638219 11:78174326-78174348 TCTCCTGGAAGTCCTCAGGCAGG + Exonic
1086362117 11:86069614-86069636 TCTCCTTTAAGCCAGGAGGGCGG - Intronic
1087523715 11:99279871-99279893 TCACCTGAAAGCACAGAGGGTGG + Intronic
1087979702 11:104596250-104596272 TCTCCTGCAAGCCCTTAGCAAGG - Intergenic
1088743373 11:112784952-112784974 CTTCCTGGAAGCCCAGATGGAGG + Intergenic
1089397898 11:118147780-118147802 ACTCCTTGGTGCCCTGAGGGAGG - Intronic
1089418645 11:118314599-118314621 TGTAATGGAAGCCCTGAGTGAGG - Intronic
1089703361 11:120259199-120259221 TCACAAGGAAGCCCTGAGGTTGG + Intronic
1089774351 11:120825950-120825972 TCCCCCGGAGGCCCTGTGGGAGG + Intronic
1090404643 11:126469427-126469449 GCTCCTTGCAGCCCTGGGGGAGG + Intronic
1091761109 12:3087958-3087980 TCTCCGACAAGCCCTGAGGGTGG + Intronic
1092263661 12:6965401-6965423 TCTCCTCCCAGCCTTGAGGGAGG + Exonic
1093751861 12:22808586-22808608 CCTTCTGGAAACACTGAGGGAGG - Intergenic
1095948093 12:47765329-47765351 TCCCCCGCAAGGCCTGAGGGGGG - Intronic
1096225635 12:49865293-49865315 CCTGCTGGAGGCTCTGAGGGAGG - Intergenic
1096229953 12:49891203-49891225 CCTCCTGGCTGCCCTGTGGGTGG - Intronic
1096244118 12:49974836-49974858 TCTGCTGGCAGCCCTGGGGAGGG + Intronic
1096818413 12:54216129-54216151 CTTCCTGCAAGCCCTGAGTGGGG + Intergenic
1096882766 12:54686037-54686059 TCTACTGGGAAACCTGAGGGAGG + Intergenic
1098301259 12:69056279-69056301 CCTCCTGGAGACCCTGAAGGAGG + Intergenic
1100155792 12:91798817-91798839 TCTGCAGGCAGTCCTGAGGGTGG - Intergenic
1100431377 12:94534418-94534440 CCTCCTGGAGGCTCTGGGGGAGG - Intergenic
1100813788 12:98366071-98366093 TCTCCCACAAGTCCTGAGGGAGG + Intergenic
1101800050 12:108013830-108013852 AGTCCTGGAAGACCTGAAGGAGG - Intergenic
1102230884 12:111261412-111261434 GCTCCTGTGAGCCCTGAGGAGGG - Intronic
1102413771 12:112742897-112742919 CCTCCTGGAAGCTCTAGGGGAGG + Intronic
1102488307 12:113273099-113273121 TCTCAAGGAATCCCTGAGGGAGG - Intronic
1102879010 12:116470031-116470053 CCTTCTGGAGGCACTGAGGGAGG - Intergenic
1103948331 12:124539141-124539163 GCCCCGGGAAGCCCTGACGGGGG - Intronic
1104447808 12:128847045-128847067 GCCCCAGGAAGCCTTGAGGGAGG + Intergenic
1104522172 12:129486016-129486038 TCAACAGGAAGCCCTGAGGCAGG - Intronic
1104636453 12:130440530-130440552 TCTCCTGAAGGCCCCGAGAGAGG + Intronic
1106792651 13:33171274-33171296 TCTCATGGAAAACCTGAGTGTGG + Intronic
1112247932 13:97751206-97751228 TGTTCTGGAAGCACTGAGGAAGG + Intergenic
1113606392 13:111610641-111610663 GCTCCTGGAAGAGCTCAGGGTGG + Intronic
1113666194 13:112143401-112143423 TCTCCGGTAGCCCCTGAGGGAGG + Intergenic
1113747368 13:112754597-112754619 TCTCCAGGAGGCCCTGAAGGTGG - Intronic
1113862390 13:113495992-113496014 GCGCCTGGAGGCCCTGAGAGAGG + Exonic
1113870066 13:113553865-113553887 TCACCTGGAAGCTCTCAGGCTGG + Intronic
1114666775 14:24382153-24382175 GCTTCTGCAGGCCCTGAGGGAGG + Intergenic
1115732192 14:36283194-36283216 TTGCTGGGAAGCCCTGAGGGAGG + Intergenic
1118315107 14:64721402-64721424 TCTCCTGGAGTCCATGTGGGAGG + Intronic
1121740742 14:96250687-96250709 TCTTCTGGAAGCCCTGCAGGTGG + Intronic
1121865795 14:97361383-97361405 CCTCCTGGATGCCCTGGGTGTGG + Intergenic
1122125496 14:99576432-99576454 TCTCCAGGCAGAGCTGAGGGTGG - Intronic
1122230266 14:100303489-100303511 TCTCCTGGGAGACTTGAGTGGGG - Intronic
1122623159 14:103071097-103071119 GCTCCTGCAAGTCCTGATGGAGG + Intergenic
1123129326 14:105972932-105972954 TGACCTGGAAGCCCTAAGTGGGG + Intergenic
1123409838 15:20049098-20049120 TGACCTGGAAGCCCTAAGTGGGG + Intergenic
1123519170 15:21055806-21055828 TGACCTGGAAGCCCTAAGTGGGG + Intergenic
1125525249 15:40370194-40370216 TGTCCTGGAAGGGCCGAGGGGGG + Exonic
1125884884 15:43221107-43221129 ACGCCTGGCAGCCCTGGGGGAGG + Exonic
1126828335 15:52573449-52573471 TCTCCTAAGAGCCCTGATGGAGG + Intergenic
1127353697 15:58177400-58177422 TGTCATGGAAGCCCAGAGGAGGG + Intronic
1128509222 15:68303220-68303242 ACTCAAGGAAGCCCTGAGGGAGG - Intronic
1128980269 15:72180505-72180527 GCCCCTGGCAGCCCTGAGTGGGG - Intronic
1129392431 15:75227025-75227047 TCTCCTGGAAGCCCTGGAGTGGG + Intergenic
1129471961 15:75761159-75761181 TCTCCTGGAAGCCCTGGAGTGGG - Intergenic
1129652778 15:77503429-77503451 TTTCCTGTAAGCCCTCAGGGTGG + Intergenic
1129655833 15:77525328-77525350 TCTCCTGGAAGGAGGGAGGGAGG + Intergenic
1129908139 15:79204221-79204243 TCTCCTAGAAGCCATGAGCCTGG - Intergenic
1131078575 15:89514968-89514990 CCTCCAGGAAGTCCTGAGTGTGG + Intergenic
1131400561 15:92122201-92122223 TCTCCTGAAAGAGCAGAGGGAGG + Intronic
1132090057 15:98940931-98940953 TTTCCTGAGAGCCCTGAGGCAGG - Intronic
1132329292 15:101000562-101000584 TCTCCTGGAAGCCCTGAGGGAGG + Intronic
1132950298 16:2558020-2558042 TCTCCGGCAAGCCCCGAGGAAGG - Intronic
1132964050 16:2642150-2642172 TCTCCGGCAAGCCCTGAGGAAGG + Intergenic
1133171449 16:3984836-3984858 TCTCCTGGCAGCCCTGGGTGCGG + Intronic
1133888495 16:9854783-9854805 ACTCCTGGAAGCACTGCTGGAGG - Intronic
1135736373 16:24934824-24934846 TGTTCTGGAAGCCCTAAGGAGGG + Intronic
1136634048 16:31508121-31508143 TATCAGGGAAGCCCTGAGGCAGG + Exonic
1136870969 16:33807934-33807956 TGACCTGGAAGCCCTGAGTGGGG - Intergenic
1137435855 16:48453726-48453748 TCTTCTGGAAGGTCTGAGGCAGG - Intergenic
1137556757 16:49475062-49475084 CCTCCTGGAAACCGTGGGGGAGG + Intergenic
1137704760 16:50526869-50526891 CCTGCTGGAAGCCCTCAGTGAGG - Intergenic
1139406856 16:66725857-66725879 TCTCCTGGAAGTCCTGGTGCTGG - Exonic
1139732663 16:68959950-68959972 CCTCCTGAAAGCCCTGAGATGGG - Intronic
1139849636 16:69942985-69943007 CCTCCTGGAAGGCATCAGGGTGG - Intergenic
1139967767 16:70755159-70755181 TCTCCCAGAAGCGCTGAGGCCGG - Intronic
1141131168 16:81437985-81438007 TCTCCTGTAAGCAGAGAGGGTGG + Intergenic
1141662469 16:85448835-85448857 TCTCCAGGAGGCCCTGGGAGAGG - Intergenic
1141923684 16:87153307-87153329 TCCCTTGGGAGCCTTGAGGGTGG + Intronic
1141980334 16:87546320-87546342 TCTCCTGCCAGCCTTGAGGAAGG - Intergenic
1142155012 16:88528948-88528970 TCTCTCGGAAACTCTGAGGGTGG + Intronic
1203101203 16_KI270728v1_random:1308124-1308146 TGACCTGGAAGCCCTGAGTGGGG + Intergenic
1142964451 17:3572035-3572057 CCTCATGGAGGCCCTGAGGCAGG + Intronic
1143784595 17:9247160-9247182 GGTCCTGGCAGCTCTGAGGGGGG + Intergenic
1143988472 17:10936130-10936152 TCTCTTAGAAGTCGTGAGGGAGG + Intergenic
1144456661 17:15424266-15424288 TCTCCTGGTAGCCTGGAGGGAGG - Intergenic
1144662736 17:17081752-17081774 TCTCCAGGCAGCCCTGAGATGGG + Intronic
1144764547 17:17725394-17725416 TCTCCTCCCGGCCCTGAGGGAGG - Intronic
1145774595 17:27519186-27519208 GCGCCTGGAAGCCCTGGGTGTGG + Intronic
1145943973 17:28759382-28759404 GCTGCTGGAGGCTCTGAGGGTGG + Exonic
1146064133 17:29622127-29622149 TCTCCAGGAAGCCCTGATCATGG + Intronic
1147155498 17:38542650-38542672 TCTCCTGGGAGCCAGTAGGGAGG + Intronic
1147740304 17:42667619-42667641 CCTCCTGGAATCCCTGAGGCTGG - Intergenic
1147893827 17:43737285-43737307 TCTCCTGACAGCCCTGTTGGGGG + Intergenic
1147905620 17:43820863-43820885 TCTCCTGGAACCCCTTGGAGGGG + Exonic
1148116423 17:45177953-45177975 TGTCATGGATGCCCTGAGGCAGG - Intergenic
1148158201 17:45435380-45435402 TCTCCTGGAACTTCTGAGGAAGG + Intergenic
1148332498 17:46820758-46820780 CCACCTGGGAGCCCTGTGGGTGG - Intronic
1148467332 17:47872857-47872879 TCTCCTGGATGCCTTGTGGGAGG - Intergenic
1148814702 17:50319191-50319213 TCTCGGGGAGGCCGTGAGGGTGG + Intergenic
1149324443 17:55515713-55515735 ACTTCTGGAGGCTCTGAGGGAGG - Intergenic
1150127637 17:62648623-62648645 CCTCCTGGGAGACCTGAGGAGGG + Intronic
1150834298 17:68550756-68550778 TCCACTGGACTCCCTGAGGGTGG + Intronic
1151194339 17:72421022-72421044 CCTCCTGGAAGCCCAGAGTCTGG + Intergenic
1151433981 17:74082851-74082873 TCCCCGGCAAGGCCTGAGGGAGG - Intergenic
1151557343 17:74853125-74853147 CCTGGTTGAAGCCCTGAGGGTGG + Intronic
1151704100 17:75757689-75757711 TCTCCTGGGAGGCATGAAGGGGG + Exonic
1151966503 17:77434305-77434327 GCTCCTGCAGGCCCTGCGGGTGG - Intronic
1152809711 17:82375670-82375692 CCTCCTGGAGACCCTCAGGGAGG - Intergenic
1153834276 18:8950161-8950183 TCACCTGTAAGCCCTGGGAGGGG + Intergenic
1153952172 18:10067082-10067104 TCACCTGGAGTCCCTGAGGAAGG + Intergenic
1154356340 18:13625303-13625325 TCTGCTGGAAGCCTGGAGAGTGG + Intronic
1157442050 18:47718956-47718978 TCTCCTGCAGGCCGTGAGGGAGG - Intergenic
1158827857 18:61243635-61243657 TCTTCTGGAAGATCTGAGGCAGG + Intergenic
1158832184 18:61291511-61291533 TCTCCAGGAAGCCATAAGGCAGG - Intergenic
1158881526 18:61783703-61783725 TTTCCTGGAATCCTAGAGGGAGG + Intergenic
1159424869 18:68272216-68272238 CCTTCTGGAGGCTCTGAGGGAGG - Intergenic
1159798211 18:72868158-72868180 CCTCCTGGAAGCCCGGAGCCTGG + Intergenic
1159809066 18:72994643-72994665 TCTCCAAGAAGCCCTGGGAGAGG - Intergenic
1160688021 19:446190-446212 TCTGCTGGAGGCTCTGAGGGAGG - Intronic
1160740153 19:681856-681878 TATCCTGGAAGGACTGAGGAAGG + Exonic
1160743604 19:699486-699508 GCTCCTGGCAGCCCTGAGGAGGG + Intergenic
1160754582 19:750905-750927 CCACCTGGAGGCCCTGGGGGTGG + Intergenic
1161388289 19:4008218-4008240 AGTCCTGGGAGCCCTGTGGGCGG - Intronic
1161405512 19:4089261-4089283 TCTCCAGGAAGTACTGAAGGGGG + Intergenic
1163413703 19:17172749-17172771 TCTCCCGGAAGTCCTGGTGGGGG - Exonic
1163445085 19:17341287-17341309 CCTCCTGGAGGCGCTGAGGAAGG + Exonic
1163574270 19:18101386-18101408 CCTCCTGGAAGCCCTGGGGCTGG + Intronic
1164478161 19:28591073-28591095 TCGCCTGCAAGCCGTCAGGGAGG - Intergenic
1164825357 19:31281293-31281315 TGTCCTGGAAGGAATGAGGGGGG - Intronic
1164825885 19:31284595-31284617 TCTGCTGGAAACCCTGGGGCAGG + Intronic
1165444713 19:35850508-35850530 TGGCCTGGAAGTCCTCAGGGTGG + Intronic
1166853666 19:45771841-45771863 GCTCCAGGAAGCCCTGGAGGAGG - Exonic
1167303921 19:48696215-48696237 TCTCCTGGAGGTCCTGAGTTGGG - Intronic
1168249885 19:55135873-55135895 GCTCCTGGAAGCCCTCTGGGGGG - Intronic
926001828 2:9339426-9339448 TCTCCTGAAAACTCTGAGGTTGG - Intronic
926762131 2:16287460-16287482 CCTGCTGGAAGCCCAGAGGGTGG + Intergenic
927692656 2:25219331-25219353 TCTCCTGGAAGCCCCTAGACCGG + Intergenic
927873616 2:26640049-26640071 CCTCGTGGAGGCCCTGAGGGTGG - Intronic
928080763 2:28310339-28310361 TCTCCTGGCTCCCCTGGGGGAGG + Intronic
928327944 2:30334951-30334973 TCACCTGGGAGCTCTCAGGGAGG - Intergenic
928420753 2:31136707-31136729 TATACTGGAAACCCTGAGCGTGG + Intronic
929037619 2:37709576-37709598 GCACCTGGAGGCCCTCAGGGTGG + Intronic
932847875 2:75153901-75153923 TTTCCTGGAATCACTGATGGTGG + Intronic
933751116 2:85602565-85602587 ATTCCTGGAAGCCCGGAGGAAGG + Intronic
933792350 2:85893152-85893174 TCCCCTGGAATCTCTGAGGTTGG - Intergenic
933807641 2:86011848-86011870 TCTCCTGGGAGGCCTGTGAGGGG + Intergenic
937123438 2:119456962-119456984 TCTTTTGGAGGCCCTGACGGAGG - Intronic
937418905 2:121738644-121738666 TGTTCTGGAAGCCGTGAAGGCGG + Intronic
937453098 2:122018701-122018723 TCTCTTGAAAGACATGAGGGAGG - Intergenic
943387614 2:187222053-187222075 TCTCAAGTAAGGCCTGAGGGTGG - Intergenic
943615648 2:190088986-190089008 TCTCATGGAAGCCCTGACTTAGG + Intronic
943782317 2:191838001-191838023 TCTGCTGGAATGCCAGAGGGGGG + Intronic
946831786 2:223735156-223735178 ACTCCTGGCAGCTCTGAAGGTGG - Intergenic
946905999 2:224416859-224416881 CCTGCGGGAAGCCCTGGGGGTGG - Intergenic
947224425 2:227826318-227826340 TGCCCTGGGAGCCCTGAGGGTGG - Intergenic
947716946 2:232345610-232345632 TCCCCAGGAAGCCCATAGGGAGG + Intergenic
947735388 2:232451931-232451953 TCCCCAGGAAGCCCATAGGGAGG + Intergenic
948389042 2:237598892-237598914 TCTTCTGGGCGCCCTGAGGGAGG + Intronic
948423090 2:237872438-237872460 TCTCCTGGGAAGCCTGAGGGAGG + Intronic
948617971 2:239213662-239213684 TCTCCTGGGAACCCTGATGCTGG - Intronic
1172442848 20:34978044-34978066 TCTCCTGGTAGCCCTGGCGGAGG - Exonic
1172486403 20:35300593-35300615 TCTCCTGGCTGACCTGGGGGAGG + Intergenic
1173499681 20:43544065-43544087 TGTCCTGGGAGCCCAGAGGAAGG + Intronic
1173979086 20:47208995-47209017 TCTTCTTGAAGCCCGTAGGGAGG - Intergenic
1175401262 20:58701227-58701249 TCTCCCGGGTGCCCTGGGGGTGG + Intronic
1175401324 20:58701358-58701380 TCTCCAGGGTGCCCTGGGGGGGG + Intronic
1175813701 20:61872741-61872763 TCACCTGGAAGTCCTGGGGCTGG - Intronic
1179026527 21:37683407-37683429 ACTCCAGGAAACCCTGAGGAAGG - Intronic
1179257133 21:39726769-39726791 CCTCCTGGAGGCCCTCAGGTAGG - Intergenic
1179878620 21:44284259-44284281 TGTCCTGGGAGCCTTGAGCGGGG - Intergenic
1180058951 21:45374971-45374993 TCTCTGGGAAGCCATGAGGCTGG + Intergenic
1180631644 22:17234135-17234157 TCTCCTGGACTCCCTCGGGGTGG - Intergenic
1181256900 22:21568388-21568410 ACTCCAGGAAGGCCTGAGGTCGG + Intronic
1181786265 22:25229525-25229547 TCTCCTGGTAGCCATGGGCGTGG - Exonic
1181818435 22:25457348-25457370 TCTCCTGGTAGCCATGGGCGTGG - Intergenic
1182026659 22:27124492-27124514 CCTTCTGGGAGCCCTCAGGGTGG - Intergenic
1182042240 22:27247289-27247311 TCACCTGGAAGCCGTTAGGGAGG + Intergenic
1182115435 22:27753693-27753715 TCCCCAGGAAGCCCTGGGTGGGG - Intronic
1182158008 22:28094096-28094118 TGTCCGGGAGGCCCTGGGGGTGG - Exonic
1182283528 22:29231448-29231470 GCTCCTGGCAGCCCTGGGGTGGG - Intronic
1182313608 22:29427167-29427189 TGTGCTGGAAACACTGAGGGGGG + Intergenic
1183038367 22:35157585-35157607 TCTGCTGGGAGGCCTCAGGGAGG - Intergenic
1183384627 22:37507942-37507964 TCTCCTGCAGGTACTGAGGGTGG + Exonic
1184506986 22:44909840-44909862 CCTCCTGGAAGGACTGAGGAAGG - Intronic
1184564515 22:45284357-45284379 TCTCCTGGAGACACTGAGGCTGG - Intergenic
1184668841 22:46002329-46002351 TCTCCTGCTGGCCCTGGGGGCGG - Intergenic
1185343758 22:50302606-50302628 TCTCCTGAAGTCCCTCAGGGTGG + Intronic
949716391 3:6936317-6936339 TTTCCTGGAAGCCTAGAGGGTGG + Intronic
949837872 3:8288882-8288904 TCTCTTGGAAGGCCAGAGGCTGG + Intergenic
949861534 3:8509714-8509736 TGTCCTGGAAAATCTGAGGGTGG - Intronic
950039165 3:9908780-9908802 TCACCTGGAAGACCTAAGGGAGG + Intronic
950096684 3:10334754-10334776 CCTACTGGAGGCACTGAGGGAGG + Intronic
950140524 3:10612065-10612087 TCTTCTGGAAGCTCAGAGTGTGG - Intronic
950184999 3:10939480-10939502 TCTCATGGAAGGCCGGAGGAAGG - Exonic
951513159 3:23527541-23527563 TCTCCTGGAAGGCCTCAGGATGG + Intronic
952581480 3:34838482-34838504 CCTCCTGGAGGATCTGAGGGAGG + Intergenic
954425086 3:50438961-50438983 TCTCCTACAACCCCTGAGGAGGG + Intronic
954763511 3:52894982-52895004 CCCCCTCGCAGCCCTGAGGGAGG - Intronic
956210581 3:66798057-66798079 GCTCCTGGGAGCCCTGTGAGGGG + Intergenic
957878130 3:86175385-86175407 TCTCCTGAAAAACCTGAGGCTGG - Intergenic
957947341 3:87081765-87081787 TCTCCTGCAGGCGCTGAGAGGGG - Intergenic
960432571 3:117587596-117587618 TCTCCTGTAAGTCCCCAGGGAGG - Intergenic
961380557 3:126493973-126493995 TCTCTAGGAACCCATGAGGGAGG - Intronic
961453444 3:127012990-127013012 TCCCCTGGAAGCCCTGGGGAGGG + Intronic
961749272 3:129085955-129085977 CCTCCTGGCTTCCCTGAGGGCGG + Intergenic
962609805 3:137065512-137065534 TCCCCTGGTAGCCCTAAGGCTGG - Intergenic
963102484 3:141620510-141620532 GGCCCTGGAAGCCCTGAGGAGGG - Intergenic
963438545 3:145305993-145306015 TCTCCTGTAGGCCCTGCAGGAGG - Intergenic
966102546 3:176289444-176289466 TCTCATGGATGCCATGAGGGAGG + Intergenic
967391509 3:188960613-188960635 TCTCCTGGAACCACAGAGTGTGG + Intronic
968590866 4:1459051-1459073 TCTCCTGGCAGCGCTCTGGGGGG + Intergenic
968664554 4:1814008-1814030 TCTCCTGACGCCCCTGAGGGTGG + Exonic
968751253 4:2390252-2390274 CCTCTTGGAACCTCTGAGGGAGG - Intronic
969297132 4:6276805-6276827 CCTCCTGGAGGCTCTGAGGGAGG + Intronic
969297859 4:6280157-6280179 CCTCATGGCAGCCCTGAGAGGGG + Intronic
969322290 4:6419755-6419777 CCCTCTGGAAGCTCTGAGGGAGG + Intronic
970027135 4:11635483-11635505 CCTCCTGGGAGCACTGAGTGTGG + Intergenic
971938981 4:33189441-33189463 CATCCTGGCAGCCCTCAGGGTGG + Intergenic
973936419 4:55851154-55851176 TCTCTTGGAAGGCCTCAGTGAGG + Intergenic
981548858 4:145921855-145921877 TTTCCTGGAACCCCTGTTGGAGG - Intronic
981728982 4:147877696-147877718 TGTCCTGTGAGCCCTGATGGTGG + Intronic
982308846 4:153962841-153962863 CCTTCTGGAGGCTCTGAGGGAGG - Intergenic
986744430 5:10731310-10731332 TCTACTGAGAGCCCTGCGGGTGG + Intronic
987432726 5:17856366-17856388 TTGCTTGGAAGCCATGAGGGTGG - Intergenic
987764582 5:22208644-22208666 TCTCCTGGAAGGCCACATGGTGG + Intronic
988298443 5:29393394-29393416 TGTCCCTGAAGCCTTGAGGGAGG - Intergenic
991899321 5:71441794-71441816 TCTCCTGGAAGGCCACATGGTGG + Intergenic
992444095 5:76819160-76819182 CCTCCTGGAAGCCCCGACGCCGG - Exonic
992726496 5:79612583-79612605 TCCCCTGGCAGCCGTGAGGGGGG + Exonic
995675436 5:114657867-114657889 TCTCATGGAACCCCAGAGGAAGG + Intergenic
998127770 5:139635870-139635892 TTTCCTGGAAGCCCTTGGGTGGG + Intergenic
999262438 5:150246087-150246109 TCTCCTGGTGGCCTTGAGAGGGG + Intronic
999394349 5:151217574-151217596 TCTTCTGGAGGCTCTGAGGGAGG + Intronic
1000981824 5:167824500-167824522 TCTCCTGGAAGCCAAGGGGCAGG + Intronic
1001429272 5:171646663-171646685 TCTGCTGGGAGCCCTGAGCTAGG + Intergenic
1001550322 5:172598073-172598095 TCTCCTGGGGGCCCAGAGGAAGG - Intergenic
1002454433 5:179338228-179338250 TCTCCTGGAATCCTTTAGGGAGG - Intronic
1003512273 6:6791431-6791453 TCTTCTGGAAGCACTGAAGAGGG - Intergenic
1003929571 6:10910881-10910903 CCTCTTGGAGGTCCTGAGGGCGG + Intronic
1004978684 6:20997665-20997687 TCTCTTGGAAACACTCAGGGTGG - Intronic
1005341219 6:24845471-24845493 TCTCATGGCAGCACAGAGGGAGG + Intronic
1006440665 6:34051782-34051804 TTCCTTGGAAGCCATGAGGGAGG + Intronic
1006878481 6:37318686-37318708 CCTCCTGGAACCCCTGGGTGGGG + Intronic
1007118355 6:39360490-39360512 TCGCCTGAAAGCCCTGAAGGTGG - Exonic
1011509460 6:88084227-88084249 TCTGCTGGAAGTCCAGAGGAAGG - Intergenic
1011585809 6:88924017-88924039 TATCCTGGAGGCCCTGAGGAGGG + Intronic
1018928855 6:168226339-168226361 TGTCCTGGAAGGCCTGAGTCTGG - Intergenic
1019687322 7:2388945-2388967 CCTCCTGGAACCCCTGAGATGGG - Intergenic
1019812831 7:3177065-3177087 CCTCCTGCAAGCTCTGAGGGAGG - Intergenic
1019927407 7:4202437-4202459 TCTTCTAGCAGCCCTGAGGCTGG - Intronic
1020687708 7:11316139-11316161 TCTCCTGGAAGCTCTTGGAGAGG + Intergenic
1020787837 7:12592059-12592081 TATCCCTGAAGCCCTGAGGGAGG + Intronic
1021613743 7:22481870-22481892 TTTCCTGTAATCCTTGAGGGTGG + Intronic
1021784884 7:24141928-24141950 TCTCCTAGGAGCCATGAAGGAGG + Intergenic
1024521323 7:50306534-50306556 TCTCCTGGAGACCCTGAGGGTGG - Intronic
1025094482 7:56086887-56086909 TCTCCAGGCAGCCCTGGGGTTGG + Intronic
1025875911 7:65479428-65479450 TATCCTTGAAGCCCTGAGGGAGG - Intergenic
1027513724 7:79115036-79115058 TCTCCTGAAAGCCAGGAGGAGGG + Intronic
1029366533 7:100119956-100119978 CCTCCTTGAAGGCTTGAGGGAGG + Intronic
1029875703 7:103749202-103749224 TCTCCTCAAAGCCATGAGTGTGG - Intronic
1032229200 7:130059734-130059756 CCTCCAGGAAACCCTGAGGCTGG - Intergenic
1032521989 7:132552488-132552510 TCTACAGGCAGCCCTGGGGGTGG + Intronic
1034960119 7:155359644-155359666 TCACCTGTCTGCCCTGAGGGGGG - Intronic
1034976644 7:155453181-155453203 TCTCCCGGGAGCCCTGGGAGGGG - Intergenic
1034986189 7:155516859-155516881 CCTCCGGGAAGCCCTTAGGTTGG + Intronic
1036062104 8:5334991-5335013 TCTCCAGGAAGTCCTGAGCCAGG - Intergenic
1037232970 8:16681863-16681885 CCTTCTGGAGGCTCTGAGGGAGG + Intergenic
1037584622 8:20268199-20268221 CCTCCTGGAGGCCCAGAGGCAGG - Intronic
1041752741 8:61278794-61278816 TATCTTGGAATCACTGAGGGTGG + Intronic
1042504824 8:69548970-69548992 TCTCCTGGGAGCCCTGGGTGGGG - Intronic
1042945279 8:74147890-74147912 TCTGCTGGAAGCAATGAGGTAGG - Intergenic
1044209426 8:89533154-89533176 TGTCCTGGTAGCCCTGGTGGTGG - Intergenic
1044915885 8:97112426-97112448 TCAGCTGGAAGCCATGAGGGTGG + Intronic
1045357057 8:101398665-101398687 TCTCCAGGCAGGCCTCAGGGAGG + Intergenic
1046501628 8:115085172-115085194 TCTCCTGGAGTCTCTGAGTGGGG - Intergenic
1047517709 8:125569506-125569528 GCTTCCGGAAGCCCAGAGGGAGG - Intergenic
1048229939 8:132628615-132628637 TCTTCTTGAAGCCTTGAGAGGGG + Intronic
1048789064 8:138083700-138083722 AATCCTGGAAGCCCTGGGGAAGG - Intergenic
1049333133 8:142065626-142065648 CCACCTGCAGGCCCTGAGGGAGG - Intergenic
1049404805 8:142447591-142447613 CCTCCTTGGAGCCCGGAGGGTGG - Intergenic
1049527297 8:143133842-143133864 TCTCCTGGTGACCCTGAGGGAGG + Intergenic
1051427063 9:16942899-16942921 TATGCTGGAAGTCCTGAAGGAGG - Intergenic
1052283703 9:26760912-26760934 TCTTCTGGAGGCCTTGAGGGGGG - Intergenic
1052670760 9:31554135-31554157 TCTCCTGGAAGTCATGAGTTGGG - Intergenic
1052833237 9:33232335-33232357 TCTCCTCTAAGACCTGAGTGTGG - Intronic
1055620416 9:78119655-78119677 CCTCCTGGAGGCCCTGGGAGAGG - Intergenic
1057567819 9:96180599-96180621 TCTTCAGGAAGCAGTGAGGGAGG - Intergenic
1058245020 9:102612226-102612248 TCTTCTGGAAGCCCTACTGGAGG - Intergenic
1058525072 9:105849693-105849715 TGTCATGGCAGCCCAGAGGGCGG - Intergenic
1059693177 9:116706080-116706102 TCTCCTTAGAGTCCTGAGGGTGG + Intronic
1060073012 9:120566708-120566730 TCTCCTGGGTGCCCTGTGGCCGG - Intronic
1060269690 9:122131857-122131879 TCTCCAGGAAGCCCAGCGGGTGG - Intergenic
1060439663 9:123626925-123626947 TCTCCTGCCATTCCTGAGGGAGG - Intronic
1061153422 9:128842616-128842638 TCTCGTGGAGGCACTGGGGGAGG - Intronic
1061600867 9:131669203-131669225 TCCTCTGGAGGCCCAGAGGGTGG - Intronic
1061617645 9:131790848-131790870 CCTCCTGGAGGCACTGAGGGAGG - Intergenic
1062008990 9:134257060-134257082 TCTCCAGGGAGCCCCGAGGCTGG + Intergenic
1062419481 9:136472970-136472992 TCTGCTGGGAGCCCTGGGGTGGG - Intronic
1062519607 9:136952179-136952201 TCTCCTGCCAGTCCTGAGGAGGG + Intronic
1062594579 9:137293275-137293297 CCTCCTGGAATCCCAGAGCGTGG - Intergenic
1062641870 9:137522922-137522944 GCTCCTGGAAGCCCTGGAGGAGG + Intronic
1185746139 X:2574948-2574970 TCTCCTGGAGGCCTGGAGGCTGG - Intergenic
1186129906 X:6455393-6455415 GCTCCTGGAAGCCATTAGGCTGG + Intergenic
1187367340 X:18675866-18675888 CCACCTGGAAGCCCTGAAGAAGG - Intergenic
1188085421 X:25896515-25896537 TCTCGAGGAATCCCTGCGGGGGG - Intergenic
1188546315 X:31311434-31311456 TCTTAGGGAAGCCCTGATGGAGG + Intronic
1188748616 X:33878162-33878184 TGACCTGGAAGCCCTCAGTGGGG - Intergenic
1189317549 X:40066646-40066668 GCCCCTGAAAGCCCTGTGGGAGG + Intronic
1190058253 X:47194573-47194595 ACCCCTGGAAGCTCTGAGCGCGG - Intronic
1190234013 X:48602213-48602235 TCTCCAGGAGGCCCTGATGGGGG - Intronic
1191099981 X:56715972-56715994 TCTTCTGCTAGCCCTGAGGTTGG - Intergenic
1191778836 X:64845871-64845893 TGTCCCTGAAGCCTTGAGGGAGG - Intergenic
1198632799 X:138660297-138660319 TTTCCTGACAGCCCTGTGGGTGG + Intronic
1200089794 X:153629187-153629209 GCTCCTGGAGTCCCTGAGGCAGG - Intergenic
1200213907 X:154359038-154359060 CCACCTGGAAGGACTGAGGGAGG + Exonic
1201274350 Y:12284463-12284485 TATCCCTGAAGCCCTGAGGGAGG + Intergenic