ID: 1132329856

View in Genome Browser
Species Human (GRCh38)
Location 15:101004735-101004757
Sequence CCTGAACTGCAGAAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 297}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132329856_1132329867 7 Left 1132329856 15:101004735-101004757 CCCTGCTCCTTCTGCAGTTCAGG 0: 1
1: 0
2: 5
3: 39
4: 297
Right 1132329867 15:101004765-101004787 CCCCAGCTCAGGGGATGTGGAGG 0: 1
1: 0
2: 2
3: 37
4: 308
1132329856_1132329861 -4 Left 1132329856 15:101004735-101004757 CCCTGCTCCTTCTGCAGTTCAGG 0: 1
1: 0
2: 5
3: 39
4: 297
Right 1132329861 15:101004754-101004776 CAGGGCTCCAGCCCCAGCTCAGG 0: 1
1: 0
2: 13
3: 76
4: 665
1132329856_1132329873 24 Left 1132329856 15:101004735-101004757 CCCTGCTCCTTCTGCAGTTCAGG 0: 1
1: 0
2: 5
3: 39
4: 297
Right 1132329873 15:101004782-101004804 TGGAGGAGGTGCTGAGAGGGAGG 0: 1
1: 2
2: 8
3: 101
4: 1170
1132329856_1132329865 4 Left 1132329856 15:101004735-101004757 CCCTGCTCCTTCTGCAGTTCAGG 0: 1
1: 0
2: 5
3: 39
4: 297
Right 1132329865 15:101004762-101004784 CAGCCCCAGCTCAGGGGATGTGG 0: 1
1: 0
2: 3
3: 58
4: 408
1132329856_1132329863 -2 Left 1132329856 15:101004735-101004757 CCCTGCTCCTTCTGCAGTTCAGG 0: 1
1: 0
2: 5
3: 39
4: 297
Right 1132329863 15:101004756-101004778 GGGCTCCAGCCCCAGCTCAGGGG 0: 1
1: 1
2: 5
3: 77
4: 557
1132329856_1132329862 -3 Left 1132329856 15:101004735-101004757 CCCTGCTCCTTCTGCAGTTCAGG 0: 1
1: 0
2: 5
3: 39
4: 297
Right 1132329862 15:101004755-101004777 AGGGCTCCAGCCCCAGCTCAGGG 0: 1
1: 0
2: 2
3: 52
4: 468
1132329856_1132329872 21 Left 1132329856 15:101004735-101004757 CCCTGCTCCTTCTGCAGTTCAGG 0: 1
1: 0
2: 5
3: 39
4: 297
Right 1132329872 15:101004779-101004801 ATGTGGAGGAGGTGCTGAGAGGG 0: 1
1: 0
2: 5
3: 57
4: 479
1132329856_1132329870 10 Left 1132329856 15:101004735-101004757 CCCTGCTCCTTCTGCAGTTCAGG 0: 1
1: 0
2: 5
3: 39
4: 297
Right 1132329870 15:101004768-101004790 CAGCTCAGGGGATGTGGAGGAGG 0: 1
1: 3
2: 4
3: 44
4: 505
1132329856_1132329871 20 Left 1132329856 15:101004735-101004757 CCCTGCTCCTTCTGCAGTTCAGG 0: 1
1: 0
2: 5
3: 39
4: 297
Right 1132329871 15:101004778-101004800 GATGTGGAGGAGGTGCTGAGAGG 0: 1
1: 0
2: 2
3: 68
4: 538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132329856 Original CRISPR CCTGAACTGCAGAAGGAGCA GGG (reversed) Intronic
901037915 1:6347312-6347334 CCAGATCCGGAGAAGGAGCAAGG + Intronic
901490893 1:9595721-9595743 CCAGAACAGCAGGAGGAACAAGG - Intronic
901628551 1:10637359-10637381 CCCGAACTGGACAGGGAGCAGGG - Exonic
902718699 1:18290232-18290254 CCTGTGCTGCAGAAGCAGCCAGG + Intronic
902932207 1:19739670-19739692 CTTGAACTGGAGAGGCAGCAAGG + Intronic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904377061 1:30088316-30088338 CCTGGCCTGCAGAAGGAGCAGGG - Intergenic
904409977 1:30319473-30319495 CCTGTCCTGCAGGAGGAGCACGG + Intergenic
904792535 1:33034588-33034610 CATGAAATGCTGAATGAGCAAGG + Intronic
904921566 1:34012188-34012210 CCTGATCTGCTGGAGGAGCAAGG - Intronic
905593514 1:39185870-39185892 CCTGAAGTGCTGAAGGACCCAGG + Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
907705353 1:56827846-56827868 CCTGAAGAGCAGAAGGATAATGG + Intergenic
907932848 1:59016268-59016290 CCTGTACTGCAAACAGAGCAAGG - Intergenic
908239529 1:62177064-62177086 CCTGAATTCCAAAAGGAGAATGG - Intergenic
908532719 1:65049113-65049135 CCTGGACTTCAAAAGGAGTAAGG + Intergenic
911407619 1:97462545-97462567 CCTGAATTTCAAAAGGAGGAGGG - Intronic
911828580 1:102520450-102520472 CATGAAGTGCAGAAGGTGAATGG - Intergenic
914799103 1:150946964-150946986 TCTGCACTGGAGAAGAAGCAAGG + Exonic
916314116 1:163428436-163428458 TCTCAACTGGAGAAGGAGGAGGG + Intergenic
916650288 1:166828817-166828839 CCTAAACTCCAAAAGGAGTAGGG - Intergenic
919519635 1:198571878-198571900 CATGAGCTGGAGATGGAGCAGGG + Intergenic
922101940 1:222484185-222484207 ACTGAACTCCAGGAGGAGGAGGG + Intergenic
922263020 1:223959307-223959329 ACTGAACTCCAGGAGGAGGAGGG + Intergenic
922728966 1:227940229-227940251 CCTGGACCCCAGAAGGGGCATGG + Intronic
922895102 1:229093800-229093822 CCTGAACTCCAAAGGGAGGAGGG - Intergenic
923160774 1:231312779-231312801 TCTGAACTGCATAAGGAGCCTGG + Intergenic
923465387 1:234243754-234243776 CCTGCACTGTAGCAGGAGCAGGG - Intronic
924344858 1:243064308-243064330 ACTGAACTCCAGGAGGAGGAGGG + Intergenic
1063028069 10:2202549-2202571 CCTGAATTCCAGAGGGAGCAGGG + Intergenic
1063119656 10:3096508-3096530 CCTGAACTGCAGCAGAAACCGGG - Intronic
1064437305 10:15322468-15322490 CCTGAACTGTAGCAGCAGCTAGG + Intronic
1066640567 10:37550852-37550874 CTGGGACTGCAGAAGGAGCTTGG - Intergenic
1068673497 10:59746573-59746595 CCAGGACTGAAGAAGGAGCATGG - Intergenic
1068733538 10:60386761-60386783 CCTGAACTGCAGGAGTGTCATGG + Intronic
1068818373 10:61344495-61344517 CCTGACCTGCAGAAACTGCAAGG - Intergenic
1069797346 10:71061867-71061889 CCGGAGCTGCAGAAAGAGCAGGG - Intergenic
1070279460 10:75038072-75038094 TCTTACCTGCAGATGGAGCAGGG + Exonic
1072958364 10:99906818-99906840 CCTGACCTACAGAAGCAGCGAGG + Intronic
1073541624 10:104319869-104319891 CCTGAATTCCAGAGGGAGGAGGG - Intronic
1074615503 10:115063565-115063587 CCTGCACTGAAAATGGAGCAAGG - Intergenic
1076425450 10:130364277-130364299 CCTGCTCTGGAGAAGGAGCAAGG - Intergenic
1076482417 10:130793187-130793209 CCTGCACTGCAGACTGTGCAGGG - Intergenic
1076607644 10:131700010-131700032 TTTGAGCTGCAGAGGGAGCATGG - Intergenic
1077077695 11:708853-708875 CCTGAAGTCCAGAGGGAGCCCGG - Intronic
1077747448 11:4923180-4923202 CCTCAACTGCAGAATGAGCAAGG - Intronic
1078040015 11:7851633-7851655 CAGGAACTGCAGAAGGTGCTGGG - Intergenic
1078353714 11:10617330-10617352 CCACAAATACAGAAGGAGCAAGG + Intronic
1078910186 11:15723872-15723894 CCTGAACTTCAGCTGGAGAAGGG - Intergenic
1079328428 11:19513936-19513958 CCTGAGCTCCAGAGGGAGCATGG + Intronic
1080872213 11:36246393-36246415 CCTGAACTGTAGAAGCCACAGGG - Intergenic
1083166711 11:60892978-60893000 CCTGAACTGCAGAAGGGAGTAGG - Intronic
1083674946 11:64319875-64319897 CCTGATCTTCAGAAGGGGAAGGG - Intronic
1083871279 11:65489899-65489921 CCTGAACAGCAGCAGCAGCTGGG + Intergenic
1087657303 11:100939837-100939859 CCTGAACTTCAGATGGAGGCGGG + Intronic
1088107682 11:106224605-106224627 CCTGAACTGGAAAAGGACAAAGG + Intergenic
1089130317 11:116207218-116207240 CCTCCACTGCAGAACGAGCATGG + Intergenic
1089662837 11:119996745-119996767 CTTGGATTGCAGAAGCAGCAAGG - Intergenic
1089810354 11:121126336-121126358 CCTCATCTGCAGCAGCAGCAGGG - Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090582870 11:128179118-128179140 CCAGAGCTGCAAAAGAAGCAGGG - Intergenic
1091271171 11:134312926-134312948 CCTCAAATGCAGACGGAGCCTGG + Intronic
1091781514 12:3216978-3217000 CCTGAACTGCAGTTGGAGGAAGG + Intronic
1092895618 12:13007466-13007488 CCTGAATTCCAAAAGGAGGAAGG - Intergenic
1094809159 12:34121147-34121169 CCTGACCTGGAGGAGGACCATGG + Intergenic
1095957138 12:47813390-47813412 CCAGAATGGCAGGAGGAGCAGGG - Intronic
1097036293 12:56126650-56126672 GCAGAACTACAGAAGGAACATGG - Exonic
1098307594 12:69117154-69117176 CCTGAACTGAAGATGGCACAGGG - Intergenic
1099272996 12:80536635-80536657 CCTTAAGAGCAGAAGGAGAAAGG + Intronic
1100680501 12:96914767-96914789 CCTGAACTGCTCAAGGTGCAAGG - Intronic
1101433907 12:104648935-104648957 CCTGAACTGCAGTGGAAGCAGGG + Intronic
1101972855 12:109328597-109328619 CATGAAATGCAGAAGGGGAAAGG - Intergenic
1102026378 12:109716035-109716057 CTTAAACACCAGAAGGAGCAGGG - Intronic
1104211856 12:126696603-126696625 GCTGAACTGCAGAGGCAGGAAGG + Intergenic
1104339886 12:127938446-127938468 CCTGAACTTCAAAGGGAGGAAGG + Intergenic
1104769139 12:131349842-131349864 GCTCAACTGCAGAAGCATCAGGG + Intergenic
1105645254 13:22311365-22311387 CCTAGCCTGCAGAAGGAGCGTGG + Intergenic
1106229124 13:27808168-27808190 CCTGAACTGATGAGGGAGCAGGG + Intergenic
1106544030 13:30715053-30715075 ATTGACCTGGAGAAGGAGCAAGG - Intronic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1108707254 13:53000860-53000882 TCTGGCCTGCAGATGGAGCAAGG + Intergenic
1110718316 13:78732846-78732868 CCTGAATTCCAGAGGGAGAAGGG - Intergenic
1111769410 13:92578108-92578130 CCTCTACTGCAAAAGGAGCTAGG - Intronic
1112418744 13:99228178-99228200 ACAGGACTGCAGATGGAGCAGGG - Intronic
1112750291 13:102576346-102576368 GCAGAAATGCAGAAGGAGCCTGG + Intergenic
1114187950 14:20417406-20417428 CCTCAGCTCCAGAAGTAGCAAGG - Intergenic
1114501204 14:23170195-23170217 CATGCACTGCATAAGTAGCAAGG + Intronic
1114760868 14:25312341-25312363 CTTGCACTGGAGAAAGAGCAAGG - Intergenic
1114826728 14:26089895-26089917 CCTGAATTCCAAAAGGAGAAGGG - Intergenic
1116664398 14:47756628-47756650 CCTTAACTACAGAAGGAAAAGGG + Intergenic
1116791772 14:49346942-49346964 CCTGAGGGGCAGAAGGAGAAGGG - Intergenic
1119104623 14:71912505-71912527 CCAAAACTGAAGAAGGAGGAAGG + Intergenic
1121348649 14:93155142-93155164 GCTGAGCTGCAGAAGCAGCTTGG - Intergenic
1121425011 14:93844331-93844353 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1121526739 14:94624409-94624431 CCTGCACAGCTGCAGGAGCAAGG - Intronic
1121563049 14:94888227-94888249 CCTGACCTGTACAATGAGCATGG + Intergenic
1121808646 14:96857581-96857603 GATGGACTGCTGAAGGAGCAAGG + Intronic
1122378651 14:101286213-101286235 CCTGAAGTCCAGGAGGAGCCCGG + Intergenic
1122683165 14:103482577-103482599 CCTAAAGTTCAGAAGGAGCTGGG - Intronic
1122894591 14:104750245-104750267 CCTGCACGGCAGGAGGAGAAAGG + Intergenic
1124064240 15:26324974-26324996 CCTGAATTCCAAAGGGAGCAGGG - Intergenic
1127863841 15:63015465-63015487 GCTGAACTGATGAAGGAGAAGGG + Intergenic
1128748398 15:70131213-70131235 CAAGGACTGCAGAAGGATCAGGG - Intergenic
1129148741 15:73673346-73673368 CCTGAACTTGGGAAGGAGCCAGG + Intergenic
1130043121 15:80421754-80421776 CCTGAGCTGCATAAGGCCCAAGG - Intronic
1130108451 15:80946187-80946209 TCTGAGCTGCAGGAAGAGCATGG - Intronic
1130741740 15:86608179-86608201 CCTGAACTGCAGGATGAGAAAGG - Intronic
1130819547 15:87479919-87479941 GCTCAGCTACAGAAGGAGCAGGG - Intergenic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1136062522 16:27736517-27736539 CCTGAACAGAAGAAGGAGCAAGG + Intronic
1136872879 16:33824522-33824544 CATGAACTGCAAAAGGAGGCAGG - Intergenic
1139470488 16:67175467-67175489 CCTGAGCTGAACATGGAGCAAGG + Exonic
1140622400 16:76751427-76751449 AGTGAACTGCAGAAGGAGAAGGG + Intergenic
1141717461 16:85735082-85735104 TCTGCCCTGCAGAGGGAGCAGGG - Intronic
1203099292 16_KI270728v1_random:1291532-1291554 CATGAACTGCAAAAGGAGGCAGG + Intergenic
1143165578 17:4895763-4895785 CCAGAAGTGGAGAAGAAGCAGGG + Exonic
1144191821 17:12853400-12853422 CCTGATCTACAGAAGGAGGTGGG + Intronic
1144860850 17:18300865-18300887 CATGGTCTGCAGAAGGGGCAGGG + Intronic
1146559321 17:33854624-33854646 CAAGATCTGCAGAAAGAGCAGGG + Intronic
1146796431 17:35784586-35784608 TCTGCACAGTAGAAGGAGCAGGG + Intronic
1146969386 17:37060219-37060241 GCTGGACTGCAGAAGAAGCGAGG + Intergenic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1147790961 17:43014091-43014113 CCTGATCTGGAAAAGGAGCCAGG - Exonic
1150543071 17:66123419-66123441 GCTGAGCTGGAGAAGGAACAGGG + Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1153573935 18:6501921-6501943 CCTGAACTCCAAAAGGAGAGTGG - Intergenic
1155402780 18:25457370-25457392 AATGACATGCAGAAGGAGCAGGG + Intergenic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155714104 18:28918521-28918543 CCTGAACTTCAGAATGAGAACGG - Intergenic
1155766143 18:29635423-29635445 GCTAAACTGCAAAAGGAGCAGGG - Intergenic
1155784145 18:29876534-29876556 TCTGAACAGCAGAAAGAGGATGG + Intergenic
1157876886 18:51282072-51282094 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1159204890 18:65236620-65236642 GCTAAACTGCAGAAAGAGCATGG + Intergenic
1160507330 18:79434430-79434452 CCTGGGGTGCAGAGGGAGCATGG - Intronic
1160543740 18:79639303-79639325 CCTGAATTCCAGAGGGAGGAGGG - Intergenic
1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG + Exonic
1163410313 19:17149871-17149893 CCAGACCTGCAGATGCAGCACGG + Intronic
1164016993 19:21262182-21262204 CCTGACCTGGAGGAGGACCACGG - Intronic
1164549067 19:29193118-29193140 ACTGAACTTGAGAAGGAGCTGGG - Intergenic
1164596510 19:29533879-29533901 CCTGAGCTGCAGAGGGAGCTCGG + Intronic
1164709204 19:30343447-30343469 CCTCAACTGGAGATGGAGCAGGG - Intronic
1164713181 19:30373857-30373879 CCTGAGCTGCAGTGGGAGCCGGG + Intronic
1165249476 19:34517725-34517747 AGTTAACTGCAGCAGGAGCATGG - Intergenic
1167169898 19:47824095-47824117 CCTGGCCTGCAGTGGGAGCAGGG + Intronic
1167358809 19:49019224-49019246 CTTGAACAGCAGAAGGTGCTTGG - Intergenic
1167586727 19:50379593-50379615 CCTGAAGTGGAGAAAGAGCTCGG + Intronic
1167794985 19:51703211-51703233 CCTGAACTGAAGACGGAGCAGGG - Intergenic
1167926448 19:52825019-52825041 CCTGAAATGCAGAGGCTGCAGGG + Intronic
1168056711 19:53868556-53868578 TCCGAAGTGCAGAAGGAGCTGGG + Intronic
1168720031 19:58549771-58549793 CCTGACCTGAAGGAGGAGGATGG + Exonic
925055344 2:852990-853012 CCTGAACTCCACAGGGAGGAGGG + Intergenic
925198639 2:1948372-1948394 CAGGAACTGCAGTAGGAGAATGG - Intronic
925348447 2:3186033-3186055 CATGAACTGCAGGAGCGGCACGG - Intergenic
926137102 2:10344041-10344063 ACTGAGCTGTCGAAGGAGCAGGG + Intronic
927929297 2:27033914-27033936 CTTGGACTGCTTAAGGAGCAGGG - Intronic
928415848 2:31091032-31091054 CCTTCACTGCTGAAGGAGGAAGG - Intronic
929903329 2:46024651-46024673 CCTGGACTTCAGAAGGAGGGTGG + Intronic
929941035 2:46334166-46334188 CATGACCAGCAGGAGGAGCATGG + Intronic
930112874 2:47694190-47694212 CCTGATAAGCAGAAGGAGCCAGG + Intergenic
930678603 2:54231482-54231504 CCTGAGATGAAGAATGAGCACGG + Intronic
931908561 2:66869428-66869450 AGGGAACTGCAGAAGGAGTAAGG + Intergenic
935639502 2:105277613-105277635 CCTGAACTGCAGCAGCATCTTGG + Exonic
935903885 2:107822518-107822540 CCCGAAGTGCAGAAAGAGCCTGG - Intergenic
936064110 2:109317566-109317588 TCTGTACCTCAGAAGGAGCAGGG - Intronic
937342369 2:121099448-121099470 CCTCACCTGCAGACGGAACAGGG - Intergenic
938154847 2:128926292-128926314 CCTAAAATCCAGGAGGAGCAAGG - Intergenic
940136974 2:150447990-150448012 CCTGACCTCCAGAAAGAGGAGGG - Intergenic
943008618 2:182418573-182418595 AATGAACTGCAGATGGAGTAAGG + Intronic
944188076 2:196971773-196971795 CCTGAACTGGAGGAGGGCCAGGG - Intronic
944736496 2:202571661-202571683 CCTGTACTGTAAAATGAGCATGG + Intergenic
948021776 2:234739074-234739096 CCTGAACTGCAAAGGGAGGAGGG - Intergenic
1168851440 20:979750-979772 CCCCAAATGCAGAAGGAGCTGGG - Intronic
1169089057 20:2846773-2846795 GCTGAACTGCTGGAGAAGCATGG - Intronic
1169653214 20:7892952-7892974 CCTGAACTGCAGAAGGACAGAGG - Intronic
1171165207 20:22964178-22964200 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1173092365 20:39985441-39985463 CCTGAACAGCGGATGGAGTAGGG - Intergenic
1173333636 20:42096130-42096152 TCTGAACTGCAGAAGTGGCCAGG - Intronic
1173773640 20:45684960-45684982 CCTGAAATGATGCAGGAGCAGGG + Exonic
1174913874 20:54635088-54635110 CCTGAACTCCAAAGGGAGGAGGG - Intronic
1175249084 20:57598107-57598129 CCTGACCTGCAGGTGGAGCTGGG + Intergenic
1176071458 20:63228869-63228891 CCTGAACTCCAAAAGGAGGAGGG + Intergenic
1178252765 21:31020512-31020534 GCTGAACAGCAGAAGGAGCTGGG + Intergenic
1181985548 22:26797888-26797910 ACTGAGCTTCAGATGGAGCAGGG + Intergenic
1182055003 22:27345644-27345666 CCTCAACTGGAGAAGGAAGAGGG - Intergenic
1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG + Intergenic
1182413003 22:30202931-30202953 CCTGAGGTGGAGAAGGAGCTTGG + Intergenic
1183145057 22:35982569-35982591 CAAGAACTGCAGAATGAACAGGG + Intronic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1183710199 22:39498841-39498863 CCTTAGCTGCAGGGGGAGCAGGG - Intergenic
1183809694 22:40244383-40244405 CCAGAGGTGCAGAAGGAGAAAGG + Intronic
1184602941 22:45554264-45554286 CGTGAACTGGGGGAGGAGCATGG - Intronic
1184933355 22:47698438-47698460 CCTGAACTCCAAAGGGAGGAGGG + Intergenic
1185196125 22:49470591-49470613 CCCCAACTGCGGAAGGAGGACGG + Intronic
949151402 3:772369-772391 CTAGAACTTCAGGAGGAGCATGG - Intergenic
950818817 3:15736036-15736058 CCTTAACTGCAGTAGAGGCAAGG + Intronic
951477202 3:23119472-23119494 CCAGAACAGCAGCAGCAGCAGGG - Intergenic
952053250 3:29412352-29412374 AGAGAACTGCAGAAGGAGAAGGG + Intronic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
953465985 3:43119948-43119970 CTGGAATTGGAGAAGGAGCATGG - Intergenic
954655363 3:52191137-52191159 CCTGATATGGAGAAGGAGCATGG - Intergenic
954945953 3:54424604-54424626 GCTGAGCTGCAGATGGAGCCAGG + Intronic
956095827 3:65714930-65714952 CCCGAAACTCAGAAGGAGCAGGG + Intronic
956378907 3:68645125-68645147 CCTGAGCTGCAGGGGGAGTAAGG - Intergenic
956696373 3:71922404-71922426 AATGAACTGTAGAAGGAGGAAGG + Intergenic
956930520 3:74037961-74037983 CTTGAACTGCAGAAGTCTCAAGG - Intergenic
959572589 3:107900671-107900693 CCTGAACATGAGAATGAGCATGG + Intergenic
960335809 3:116416287-116416309 CCAGAACTGGAAAAGGAGTAAGG + Intronic
961175729 3:124833699-124833721 CCTGAACTTCAGAAGCATAAAGG + Intronic
961482566 3:127193419-127193441 GCTGAACTGCAAGAGAAGCAGGG - Intronic
964746733 3:160019585-160019607 TCTGAACTGCATAAGGAGCCTGG - Intronic
967921733 3:194619130-194619152 CCTGAGCAGCAGCAAGAGCAAGG - Intronic
967931455 3:194693374-194693396 TGTGAACTGGAGAAGGAGGAAGG - Intergenic
968289226 3:197525864-197525886 ACAGACCTGCAGAGGGAGCACGG - Intronic
968360345 3:198142670-198142692 CATAAAGTGGAGAAGGAGCAGGG - Intergenic
969601613 4:8179735-8179757 CCTGACCTGCAGAGGGTCCATGG + Intergenic
970723862 4:19019739-19019761 CCAGAAGTGCGGAAGGATCATGG - Intergenic
973971461 4:56217708-56217730 CCTGAATTGCAAAGGGAGGAAGG + Intronic
975096473 4:70462859-70462881 CAGGAACTGCAGCAGGAGGATGG + Intronic
980265996 4:130516654-130516676 CCTGAATTGCTGCTGGAGCAAGG + Intergenic
981609946 4:146582604-146582626 GCTGAACTTCAGAGGAAGCAAGG + Intergenic
982415013 4:155120769-155120791 CCTGAATTCCAAAAGGAGGAAGG - Intergenic
984408803 4:179369541-179369563 CCTCAACTGCAAAAGGACGAGGG - Intergenic
984463092 4:180059606-180059628 CCTTCCGTGCAGAAGGAGCAAGG - Intergenic
984470982 4:180173160-180173182 CCTGTTCTGCAGACGGAGAATGG + Intergenic
986561108 5:9061590-9061612 CCTGAGCTGCGGCAGGAGAAAGG + Intronic
987119078 5:14749335-14749357 CCTGAACTCTAGAAGCAGAATGG + Intronic
987284436 5:16441570-16441592 CCCCAACTGCAGAAGGGGTAGGG + Intergenic
987381064 5:17286667-17286689 CCTGAAAGGATGAAGGAGCAAGG - Intergenic
989465184 5:41746797-41746819 CCAGGACTGCAGGAGGAGAAGGG - Intronic
990114179 5:52368388-52368410 CCTGGAGTGCAGCAGGAGTAAGG - Intergenic
990115830 5:52389243-52389265 CCTGAACTACTGAAGGAGCCAGG + Intergenic
990494329 5:56332432-56332454 CCTGAAATGCAGGTGAAGCAGGG - Intergenic
990816211 5:59788309-59788331 CTTGTACTGAAGAAGGAGCTGGG + Intronic
992911175 5:81397448-81397470 CCTGAACAGCAGAGGCAGCCGGG + Intergenic
993138115 5:83996370-83996392 ACTGAGCAGCAGAAGGAACAAGG + Intronic
993272005 5:85808756-85808778 CCTGAATTTCAAAAGGAGGAGGG + Intergenic
993363110 5:87002379-87002401 CCTGAAATACAGTAGGGGCATGG - Intergenic
993861762 5:93145097-93145119 ACAGAACTGGAGGAGGAGCATGG - Intergenic
994867384 5:105293650-105293672 CCTGAATTCCAAAAGGAGGAGGG - Intergenic
995281417 5:110339918-110339940 CCTGAACTCCAAAAAGAGGAGGG + Intronic
995369269 5:111400619-111400641 CCAGAAAAGCAGAAGGAGCAAGG - Intronic
995876091 5:116791714-116791736 CTTGAACTGAAGAAAGAGAAGGG + Intergenic
997633038 5:135384491-135384513 CCTGACCTGGGGAAGAAGCAGGG - Intronic
998032736 5:138885842-138885864 CTTGAACTGCAGCAAGAACAGGG - Intronic
999052051 5:148533518-148533540 CCTTAATTGCAGAAGGAGCACGG - Intronic
999128064 5:149261316-149261338 CCTTTACTGCAGCAGGATCATGG - Intergenic
999207067 5:149856692-149856714 CCTGATTTGCAGAAGCAGTATGG + Intergenic
999251079 5:150182746-150182768 CCTGAGAAGCAGAAGGAGCCGGG - Exonic
999437193 5:151571920-151571942 TGTGAACTGGAGAAGTAGCATGG - Intergenic
1000203027 5:159030599-159030621 GCAGCCCTGCAGAAGGAGCAAGG + Intronic
1001455376 5:171856023-171856045 CCTCAGCGTCAGAAGGAGCAAGG + Intergenic
1002332182 5:178450850-178450872 CATGAACTGCAGACAGAGCCAGG + Intronic
1002407268 5:179044898-179044920 CCTAAACTCCAGAGGGAGGAGGG + Intergenic
1002427838 5:179186328-179186350 GCTGGACAGCAGAAGGAGCCCGG - Intronic
1002810431 6:623021-623043 CCTCATCCTCAGAAGGAGCAGGG + Intronic
1003093759 6:3126149-3126171 ACTGAAATGCAGAAGGGGTATGG - Intronic
1004461718 6:15842819-15842841 CCTGGACTTATGAAGGAGCATGG + Intergenic
1005132913 6:22532314-22532336 CTTTAACTTCAGAAGGAACATGG + Intergenic
1006155579 6:32011270-32011292 CCAGAACTGCAGAGGGGTCAAGG + Intergenic
1006161911 6:32044124-32044146 CCAGAACTGCAGAGGGGTCAAGG + Exonic
1006598028 6:35207785-35207807 CCTGAACTGTGGCAGCAGCAAGG + Intergenic
1006627306 6:35406438-35406460 CCTCAGCTGTAGATGGAGCAAGG + Intronic
1007217833 6:40254293-40254315 CCTGAACTGCAGCAGGAGAGAGG - Intergenic
1007821156 6:44561516-44561538 CCTGAGCTGCAGAAGGAAAGCGG - Intergenic
1008541158 6:52547401-52547423 TCCGAACTGCACAAGCAGCAGGG - Intronic
1009494659 6:64332183-64332205 CCTGACATGGAGAAGGACCACGG - Intronic
1010034361 6:71306344-71306366 ACTAGAATGCAGAAGGAGCAGGG - Exonic
1011535258 6:88369808-88369830 CCTGAACCACAGAGGGAGGAGGG + Intergenic
1011983129 6:93410565-93410587 ACTGCAGTGCAGAAGGAGAATGG - Exonic
1013607347 6:111762459-111762481 CCTGAACTCCAAAGGGAGGAGGG - Intronic
1014157848 6:118132845-118132867 ACTGAAATGCAGAAGGGGCGGGG + Intronic
1014779401 6:125546312-125546334 CCAGAATTGCAGAATAAGCAAGG - Intergenic
1017102113 6:150857991-150858013 CCCCAAATGCAGAAGGAGCCTGG - Intergenic
1019259657 7:73962-73984 CATAAAGTGGAGAAGGAGCAGGG + Intergenic
1019597340 7:1864246-1864268 CCTGAACACCTGAAGGAGGAGGG + Intronic
1020468106 7:8504051-8504073 CCTGAAATGAAGCAGGGGCAGGG - Intronic
1020517793 7:9145750-9145772 GGTGAAATGCAGAAGGATCAGGG - Intergenic
1021234635 7:18127445-18127467 CCAGAAGTACAGAGGGAGCAGGG - Intronic
1021568478 7:22038717-22038739 CCTGAAAAGCAGAAGCTGCAGGG - Intergenic
1021585583 7:22203918-22203940 CCTGAAATGTAGAAGAAGAAAGG + Intronic
1021595758 7:22314928-22314950 CCTTGAGTGCATAAGGAGCAGGG - Intronic
1023731208 7:43194108-43194130 CCTGAACTCCAAAGGGAGGAGGG + Intronic
1024034511 7:45495806-45495828 CCTGAATTCCAGAGGGAGGAGGG + Intergenic
1024976566 7:55119039-55119061 CTTGAACTGTAAAATGAGCAGGG - Intronic
1025142592 7:56478518-56478540 GATGAGCTGCAGAAGGAGCAGGG + Intergenic
1025610806 7:63074056-63074078 GATGAGCTGCAGAAGGAGCAGGG - Intergenic
1025708653 7:63889119-63889141 GATGAGCTGCAGAAGGAGCAGGG + Intergenic
1026460561 7:70611320-70611342 TCTAGACCGCAGAAGGAGCAAGG - Intronic
1026522521 7:71129951-71129973 CATGAACTCCAGAAAGAGGAGGG + Intergenic
1027248459 7:76383342-76383364 CCTGGCCTGCAGAAGAACCACGG - Intergenic
1028135604 7:87220272-87220294 CCGGAACTGCAGCAGGAGTACGG + Intronic
1029379618 7:100204633-100204655 ACAGAACTGCTGCAGGAGCATGG + Exonic
1030093995 7:105881605-105881627 CCTGAGGTTCAGAAGGATCAAGG - Intronic
1030210430 7:106990531-106990553 CCTGATATCCAGTAGGAGCATGG - Intergenic
1030558099 7:111051977-111051999 CCTAAACTCCAAAGGGAGCATGG - Intronic
1030616224 7:111740806-111740828 CCTGGACTGCAGAAGGAACTTGG + Intronic
1031882079 7:127209227-127209249 ACTGCACTGGATAAGGAGCAGGG + Intronic
1034109866 7:148526531-148526553 CCTGAACTCCAAAGGGAGGAAGG - Intergenic
1034678689 7:152911408-152911430 CCTGAACTTCAGAAAGAGCCAGG + Intergenic
1036470483 8:9048441-9048463 CCAGAGCTGCAGAAGGAGTTTGG - Intronic
1036546445 8:9774575-9774597 ACTGAACTGCAGAACTAGAAGGG - Intronic
1036699376 8:11001888-11001910 GCTGAACAGCAGAGGGACCAGGG - Intronic
1037287667 8:17318481-17318503 CTGGAACTGCAGCAGGAGGATGG + Intronic
1037987034 8:23296465-23296487 CCTGAACTGCCAAAGGAGTGTGG - Intergenic
1039414352 8:37380590-37380612 CCTGAGCTGCAGGAGGCCCATGG - Intergenic
1043395505 8:79831909-79831931 CCTGAACTGCAAATGGGCCAGGG + Intergenic
1045290827 8:100831260-100831282 CCTGAACTCCAAAGGGAGGAGGG + Intergenic
1045956268 8:107911329-107911351 CCTAACCTGGAGAAGTAGCAGGG + Intronic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1047782634 8:128122664-128122686 CCTCAACTGCAAAGAGAGCAAGG - Intergenic
1049378286 8:142299439-142299461 CCTCATCTGCAGAAGGCGCTAGG - Intronic
1050404292 9:5291869-5291891 CCTGAAATGCAGACCGAGAAAGG + Intergenic
1052171047 9:25396938-25396960 CCTGAATTCCAAAAGGAGAAGGG - Intergenic
1060576220 9:124697277-124697299 CCTGGACTGCAACAGGAGCCAGG + Intronic
1060934233 9:127506374-127506396 CCCTAACTGCGGAAGGAGCAGGG + Exonic
1060994281 9:127867479-127867501 CCTGGACTGCACAGGCAGCAAGG - Exonic
1061937513 9:133866362-133866384 CCTGCTCTGCAGAAGGCGTAGGG - Intronic
1062050334 9:134443759-134443781 CTTGGCCTGCAGCAGGAGCAGGG + Intergenic
1062745044 9:138206500-138206522 CATAAAGTGGAGAAGGAGCAGGG - Intergenic
1186265585 X:7830203-7830225 TATGTACTGCAGAAGGAACAGGG + Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186811922 X:13198672-13198694 CCTGAACTCCAAAGGGAGGAGGG - Intergenic
1189464294 X:41266654-41266676 CTTGGACTGCAGAAGAGGCACGG + Intergenic
1190343150 X:49313352-49313374 CCTGACCTGGAGGAGGACCATGG - Intronic
1193845283 X:86462662-86462684 CCTGCTCTGAAGAATGAGCAGGG - Intronic
1194072956 X:89350491-89350513 CCTGACCTGGAGTGGGAGCAGGG - Intergenic
1196187348 X:112758556-112758578 CATGAAATTCAGAAGTAGCATGG - Intergenic
1196867542 X:120083617-120083639 CCTGACCTGGAGGAGGACCATGG + Intergenic
1196875559 X:120152664-120152686 CCTGACCTGGAGGAGGACCATGG - Intergenic
1197723063 X:129758108-129758130 ACTGAACTGATGGAGGAGCAAGG + Intronic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1199388471 X:147250956-147250978 CCTGAACCACAGAATAAGCAGGG + Intergenic
1199986757 X:152958376-152958398 GTTGAACTGCAGCAGGAACAAGG + Intronic
1200443561 Y:3237293-3237315 CCTGACCTGGAGGAGGACCATGG + Intergenic
1200727195 Y:6686231-6686253 CCTGACCTGGAGTGGGAGCAGGG - Intergenic
1200728347 Y:6702006-6702028 CCTGACCTGGAGTGGGAGCAGGG - Intergenic
1200790862 Y:7298003-7298025 TCTGAAGTGCAGATGCAGCAGGG + Intergenic
1201263937 Y:12187727-12187749 CCTGAATTCCAAAAGGAGAAGGG - Intergenic
1201278217 Y:12318053-12318075 CCTGACCTGGAGGAGGACCATGG - Intergenic
1201358118 Y:13117361-13117383 CCTGACCTGGAGGAGGACCATGG - Intergenic
1201622819 Y:15979497-15979519 CTTTAACTCCAGTAGGAGCAAGG + Intergenic
1201896741 Y:18999970-18999992 CCTGACTTGGAGAAGGAACATGG - Intergenic