ID: 1132330695

View in Genome Browser
Species Human (GRCh38)
Location 15:101010428-101010450
Sequence CCTGCGATGGAGAAGAAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 8, 3: 28, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132330695_1132330700 27 Left 1132330695 15:101010428-101010450 CCTTCCTTCTTCTCCATCGCAGG 0: 1
1: 0
2: 8
3: 28
4: 283
Right 1132330700 15:101010478-101010500 AAGTTGTCCCACCTCCCTCCTGG 0: 1
1: 0
2: 4
3: 16
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132330695 Original CRISPR CCTGCGATGGAGAAGAAGGA AGG (reversed) Exonic
900034046 1:392243-392265 CATGGGATGGAGAGAAAGGAGGG - Intergenic
900054882 1:622133-622155 CATGGGATGGAGAGAAAGGAGGG - Intergenic
901115508 1:6840716-6840738 CCTGGGATGCAGAAGATAGATGG + Intronic
901198810 1:7455191-7455213 CCTGCACTAGAGAAGCAGGAGGG - Intronic
901838532 1:11939339-11939361 CCTGGGGTGGGGATGAAGGATGG + Intronic
902292606 1:15445225-15445247 CCTGGGAAGGTGAGGAAGGAGGG - Intronic
906001465 1:42429899-42429921 CCTGTGATGGAGAGGACAGAGGG - Intergenic
906852956 1:49271714-49271736 CCAAAGATGGAGAAGAAGGAGGG - Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907794179 1:57698192-57698214 CTTGAGAGGGTGAAGAAGGAGGG - Intronic
910517344 1:88076725-88076747 CCTGTGATGGACAGGAAAGAGGG + Intergenic
910543600 1:88389091-88389113 CATGTGTTGGAGAAGAAGGATGG - Intergenic
910770320 1:90824333-90824355 TTTGAGGTGGAGAAGAAGGAAGG - Intergenic
911099495 1:94083541-94083563 CCTGCGATCAGAAAGAAGGAGGG - Intronic
911680557 1:100710635-100710657 CCTGCAAAGCAGAAGAAGGCAGG - Intergenic
913296021 1:117321156-117321178 CCTGCGTCTGGGAAGAAGGAAGG + Intergenic
914799103 1:150946964-150946986 TCTGCACTGGAGAAGAAGCAAGG + Exonic
915358052 1:155268445-155268467 CCTGGGGTGGAGATGAAGGAAGG + Intronic
915921323 1:159977910-159977932 CCTGCCATGGGGAAAAGGGAGGG + Intergenic
918050493 1:180968861-180968883 CCAGCCATGGGGAAGCAGGAGGG - Intergenic
918060986 1:181061044-181061066 CCAGCCATGGGGAAGCAGGAGGG - Exonic
918469545 1:184857300-184857322 ACAGCAAAGGAGAAGAAGGAAGG - Intronic
921157384 1:212449188-212449210 CCTGGGATGAAGAAGGAGGGAGG + Intergenic
922256400 1:223896407-223896429 CATGGGATGGAGAGAAAGGAGGG - Intergenic
923191671 1:231626437-231626459 ACAGTGATGGAGAAGATGGAGGG - Intronic
923246390 1:232136658-232136680 CCTGGGATGGAGGCGAGGGAGGG + Intergenic
924215966 1:241822884-241822906 CATAGAATGGAGAAGAAGGATGG - Intergenic
924385485 1:243495404-243495426 CCTGCGGTGGAAGGGAAGGAGGG + Intronic
1062791844 10:311669-311691 AATGGGATGGAGAAGAGGGAGGG + Intronic
1064310545 10:14208518-14208540 CCTGCCTTGGGGAAGGAGGAGGG + Intronic
1064570839 10:16691530-16691552 CTTGGGAAGGAGAAGAAGGTTGG - Intronic
1065024274 10:21526210-21526232 CCTGCGAGGGAGGGGAGGGACGG + Intergenic
1065253521 10:23841249-23841271 CCTGCGATGTAAAAGCTGGAGGG + Intronic
1067185033 10:44020240-44020262 CCTGCCAAGGATAAGAAGTAGGG - Intergenic
1067358090 10:45549787-45549809 CCTGGGATGGAGAGAAGGGAAGG - Intronic
1067991467 10:51217930-51217952 CCTGAGATTCAGATGAAGGAGGG - Intronic
1068511217 10:57968281-57968303 CCTGGGGTAGAGATGAAGGATGG + Intergenic
1068960460 10:62862027-62862049 GCAGGGATGGAGCAGAAGGAAGG - Intronic
1070902928 10:80046712-80046734 CATACAATGTAGAAGAAGGAAGG + Intergenic
1071268262 10:83983614-83983636 GCTGGAATGGAGAAGGAGGAGGG - Intergenic
1071970127 10:90896674-90896696 CTGGTGAGGGAGAAGAAGGAAGG - Intronic
1072482082 10:95818714-95818736 TCCCTGATGGAGAAGAAGGAAGG + Intronic
1075609318 10:123838909-123838931 CCTGTGAGGGAGAAGAGGGGAGG + Intronic
1075680808 10:124329952-124329974 CAGGGGATGGAGAAGAAGAATGG - Intergenic
1075904061 10:126065292-126065314 CCTCAGAGGAAGAAGAAGGAGGG + Intronic
1076367985 10:129934506-129934528 CCTGAGATGAGGAAGCAGGAGGG - Intronic
1076425450 10:130364277-130364299 CCTGCTCTGGAGAAGGAGCAAGG - Intergenic
1078953912 11:16167830-16167852 ACTGCTATGGAGAAAAAGCAGGG - Intronic
1082217733 11:49595192-49595214 CATGGGAAGGAGAACAAGGAGGG + Intergenic
1082820648 11:57542637-57542659 CCAGAGATGGAGCAGAAGGAAGG + Exonic
1084644360 11:70446053-70446075 CCTGGGATGGGGGAGCAGGAGGG + Intergenic
1084936921 11:72591805-72591827 CCTGCCATGGTGAGGATGGACGG + Intronic
1085171077 11:74450483-74450505 CCTGCGGGGGAGAATTAGGAGGG + Intergenic
1085294453 11:75423240-75423262 CAGGGGATGGAGAAGAAGGTAGG + Intronic
1085386438 11:76160821-76160843 CCTGGGAGGGAGGACAAGGAGGG - Intergenic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1089200747 11:116723499-116723521 CCTGCGATTGAGAAGCAGTGGGG + Intergenic
1089317321 11:117600861-117600883 CCAGAGCTGGAGGAGAAGGAGGG + Intronic
1089327599 11:117667884-117667906 CTTGCAGTGGAGAAGAAGGGAGG + Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1091653070 12:2323974-2323996 CCTGCGATGGAGAACTGGAATGG - Intronic
1092269135 12:7008380-7008402 TCTGTGCTTGAGAAGAAGGATGG + Intronic
1092930196 12:13308542-13308564 TCAGCTATGGAAAAGAAGGAAGG + Intergenic
1094605509 12:31945608-31945630 ACTGCCATGCAGAAAAAGGAGGG + Intergenic
1100478423 12:94955196-94955218 CCACCCATGGAAAAGAAGGAAGG + Intronic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1101709151 12:107248828-107248850 ACTGAGATGGAGAAGAATGCAGG - Intergenic
1102215845 12:111160889-111160911 CCTGCCATGGGGAAGATGCAGGG + Intronic
1102747288 12:115260352-115260374 ACTGCTATGGAGAAAAAGCAAGG - Intergenic
1102952215 12:117038415-117038437 CCTAGGATGGAGAACACGGATGG + Intergenic
1103962554 12:124618001-124618023 CCTGCGGTGGAGAAGGAAGAGGG + Intergenic
1104248414 12:127065093-127065115 CTTGCCATGGAGATGGAGGAAGG - Intergenic
1104956511 12:132469228-132469250 CATGCCATGGAGAAAAAGTAAGG + Intergenic
1105239214 13:18595557-18595579 CCTGCCTTGGAGAAGAAGGAAGG + Intergenic
1105482500 13:20791991-20792013 CCTGCTCTGGAGCAGAAGGCTGG + Intronic
1105811500 13:24000355-24000377 CCAGTGATGGAGAATATGGAAGG + Intronic
1105853599 13:24357760-24357782 CCTGAGAGGGAGAAGAACCAAGG - Intergenic
1107415395 13:40195098-40195120 CTGGTGATGAAGAAGAAGGAGGG - Intergenic
1109179673 13:59199104-59199126 TCAGAGATGTAGAAGAAGGATGG + Intergenic
1113305704 13:109076275-109076297 CCTAAGAAGAAGAAGAAGGAAGG - Intronic
1120436829 14:84493211-84493233 ACTCCTATGGAGAAGAAGGGAGG + Intergenic
1123492037 15:20788527-20788549 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1123548541 15:21357617-21357639 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1124346389 15:28924174-28924196 CCTGAGGTTGAGAACAAGGAGGG - Intronic
1125030999 15:35076026-35076048 ATTGAGATGGAGAAGATGGATGG - Intergenic
1125603273 15:40926897-40926919 CCCGAGTGGGAGAAGAAGGAAGG + Intergenic
1127588022 15:60397066-60397088 CCGGCTGTTGAGAAGAAGGAGGG - Intronic
1127681047 15:61298760-61298782 TCTGCTATGGTGAAGAAGCATGG - Intergenic
1127682180 15:61308662-61308684 CTGGGGGTGGAGAAGAAGGAAGG - Intergenic
1129159470 15:73739397-73739419 TCTGCCTTGGAGTAGAAGGATGG + Exonic
1129992040 15:79973868-79973890 CCTGTGAGGGAAAAGAGGGAGGG - Intergenic
1130152931 15:81324791-81324813 CCTGAGATGGAGAAGAGATAGGG + Intergenic
1131071520 15:89469475-89469497 ACTGCCATGCAGAAAAAGGAGGG - Intergenic
1132330695 15:101010428-101010450 CCTGCGATGGAGAAGAAGGAAGG - Exonic
1202956875 15_KI270727v1_random:84848-84870 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1133699200 16:8293566-8293588 CCTGTGCTGGGGAAGATGGAGGG - Intergenic
1135110509 16:19687225-19687247 CCAGCAATGGAGAAGAGGGAAGG - Intronic
1136107387 16:28039960-28039982 ACTGAGATGGAGAAAAACGAGGG - Intronic
1137840625 16:51637474-51637496 CAAGAGAGGGAGAAGAAGGAGGG + Intergenic
1139962795 16:70727677-70727699 AGTGCAATGGAGAAGCAGGAGGG + Intronic
1140480329 16:75258955-75258977 CCTGGGAAGGAGGAGGAGGAGGG + Intronic
1141263318 16:82473466-82473488 CAAGCAATAGAGAAGAAGGAAGG - Intergenic
1141804827 16:86335720-86335742 CCTGCGAAGGAAAATAAGGCAGG - Intergenic
1142129171 16:88424957-88424979 CCTGAGAGGGAGAGGAAGGCCGG - Intergenic
1142305657 16:89283501-89283523 CGAGAGAAGGAGAAGAAGGATGG - Exonic
1142395477 16:89828988-89829010 CCGGGGAGGGAGAGGAAGGAGGG - Intronic
1203141663 16_KI270728v1_random:1771309-1771331 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141710 16_KI270728v1_random:1771452-1771474 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141842 16_KI270728v1_random:1771910-1771932 CCTGGGATTGAGATGGAGGAAGG - Intergenic
1142986923 17:3700997-3701019 CCTGTGAGGGAGGAGAAGGAGGG - Intergenic
1144384192 17:14733832-14733854 GATGCAATTGAGAAGAAGGACGG + Intergenic
1145199461 17:20929557-20929579 TGTGCGCTGGAGAAAAAGGATGG + Intergenic
1146720660 17:35121290-35121312 CCTGGGAAGGAGAATAAGGATGG - Exonic
1148182172 17:45614060-45614082 CCACCGATGGAGAAGAAGGGCGG - Intergenic
1148266686 17:46231636-46231658 CCACCGATGGAGAAGAAGGGCGG + Intergenic
1149139046 17:53407872-53407894 GCTGAGATGGAGAATAAGCAGGG - Intergenic
1149650811 17:58275335-58275357 CCTGCGAAGAAGGAGAGGGAAGG + Intronic
1150282123 17:63934775-63934797 CCTGGGCTGGAGAAGGAGGCAGG - Intergenic
1150584132 17:66502124-66502146 CCTGCTATGAAGAGGAAGAATGG + Intronic
1151482998 17:74381105-74381127 CCTGGGAAGAAGAAGAAGGGAGG - Intergenic
1152011667 17:77722685-77722707 GCTGAGAAGGAGGAGAAGGAGGG - Intergenic
1152045070 17:77930135-77930157 CCTGCCATGGACAAGCAGAAAGG - Intergenic
1152629160 17:81402056-81402078 CCTGGGATCAAGAAGAAGCAGGG - Intronic
1154983081 18:21520587-21520609 CCTGAAATAGAGAAAAAGGAAGG + Intronic
1155100400 18:22605112-22605134 CCTGGGATGGAGGTGAGGGATGG - Intergenic
1156409238 18:36811892-36811914 TCTGCCAAGGAGAAAAAGGAAGG - Intronic
1157584638 18:48793241-48793263 CCTGCCAGGGAGAAGCAGGGAGG + Intronic
1157744555 18:50123478-50123500 CCAGCGATGGAGGATAAGGTGGG + Intronic
1158099856 18:53818947-53818969 CCTGGGCTGGAGGAGGAGGAAGG + Intergenic
1158983031 18:62783916-62783938 CCTGAGAATGAGAAGAAAGATGG + Intronic
1160231310 18:77051703-77051725 CCTTCCAGGGAGAAGAAGAAAGG + Intronic
1161342441 19:3750708-3750730 CCAGGGAGGGAGAAGGAGGACGG - Exonic
1161636487 19:5392568-5392590 CCTCCGCTGGAGAGGCAGGAAGG - Intergenic
1161819689 19:6522266-6522288 CCTCAGAGGCAGAAGAAGGAGGG + Intergenic
1163000564 19:14363994-14364016 TTTGCGATGGAGAGGCAGGAGGG - Intergenic
1163178669 19:15583653-15583675 CCCGGGATGGAGAAGGCGGAAGG - Intergenic
1163245221 19:16089325-16089347 CCTGAGATGGAGATCAAAGATGG - Intronic
1163634535 19:18431978-18432000 CCTGGGGTGGGGCAGAAGGAAGG - Exonic
1164526533 19:29017321-29017343 CCCTCCATGGAGAAGGAGGATGG - Intergenic
1165073604 19:33269110-33269132 CCTGGGAGGGAGCAGGAGGAAGG - Intergenic
1165297127 19:34936437-34936459 CGTGAGATGGTAAAGAAGGAAGG + Intronic
1165401465 19:35603391-35603413 CCTGCACTGGAGGAGAAAGATGG + Intergenic
1166988264 19:46675212-46675234 CCTGAGCTGGTGCAGAAGGAAGG - Intronic
1167254405 19:48418651-48418673 CCAGCGAGGGAGAAGGAGGGAGG + Intronic
1168200671 19:54813191-54813213 CCAGCGATGAAGGAGAAAGAAGG - Intronic
1168238018 19:55075840-55075862 CCTGGGAGGGAGCAGGAGGAGGG + Intronic
1168446000 19:56414398-56414420 CCCTGGATGGTGAAGAAGGAGGG + Exonic
1168647018 19:58065975-58065997 CCTGCCATGAAGGAGGAGGAGGG + Intronic
925998823 2:9313771-9313793 CCTGGGCTTGGGAAGAAGGAAGG - Intronic
926636609 2:15186809-15186831 TGTACGATGGAGAACAAGGAAGG - Exonic
927325148 2:21796661-21796683 CCTGCCATGGAGAATAAATATGG - Intergenic
927876546 2:26659109-26659131 GCTGCGGTGGAGAAGAATGTGGG - Intergenic
928174460 2:29024438-29024460 CCTGGGATGTGAAAGAAGGAGGG + Intronic
929250875 2:39753624-39753646 ACTGAGATGGGGAAGACGGATGG - Intronic
929882796 2:45851904-45851926 CCTGCCATGGAGAGGCAGGTGGG + Intronic
930231468 2:48847941-48847963 CCAGGGAGGGAGAAGAAGAAAGG - Intergenic
930271262 2:49260301-49260323 ACTGAGATGGAGAACAAGGAAGG + Intergenic
932704827 2:74015380-74015402 ACTGGGATGGAGAAGAAATAGGG - Intronic
933971735 2:87475232-87475254 GCTGCGGTGGAGCAGAAGGCTGG + Intergenic
934854224 2:97718911-97718933 GCTGGGTTGGAGAAGATGGAGGG + Intronic
934936877 2:98472137-98472159 CCTGCCGTGGAGCAGAAGTATGG + Intronic
936632039 2:114214362-114214384 CTTGGGGTGGGGAAGAAGGAAGG - Intergenic
940479710 2:154212715-154212737 CCTTAGAAGGAGAAGAAGGATGG - Intronic
941299852 2:163787752-163787774 CTTGCGATGCATAGGAAGGAGGG - Intergenic
941466664 2:165836364-165836386 AATGGGATGGAAAAGAAGGAAGG - Intergenic
941648116 2:168063930-168063952 CCTGCAATGCAGAGGAAGGCGGG + Intronic
944223166 2:197322787-197322809 GCTGTGAAGGAGAAGAAAGAGGG - Intergenic
944488244 2:200229644-200229666 ACTGCTATGGAGAGGAAGCATGG - Intergenic
946237390 2:218332541-218332563 GCTGAGATGGGGAAGGAGGAAGG - Intronic
947323763 2:228952235-228952257 CCAGAGAGGGAGAAGAGGGAGGG + Intronic
947713390 2:232328365-232328387 CCTGAGATGCAGAGGAAGAAGGG - Intronic
948227023 2:236319115-236319137 GCTGCGATGAAGAAGGAGGAGGG - Intergenic
1169264133 20:4157407-4157429 CCTGCAGAGGAGAAGAAAGAGGG + Intronic
1172189211 20:33051814-33051836 GCTAAGATGGGGAAGAAGGATGG - Intergenic
1173856232 20:46252163-46252185 GCTGCGATGGATAGGAAGGCAGG - Intronic
1173868441 20:46327651-46327673 CCTGGGGTGGAGGAGAAGGAAGG + Intergenic
1173873375 20:46355358-46355380 CCTGGGATGGAGCTGAAGGGTGG - Intronic
1175500933 20:59450284-59450306 CCTGTGTGGGAGCAGAAGGATGG + Intergenic
1175851549 20:62096758-62096780 CCTCAGATGGCGAAGAATGAGGG - Intergenic
1176261701 20:64185306-64185328 CCTGTGCTGGAGACGGAGGAGGG + Intronic
1176446586 21:6827306-6827328 CCTGCCTTGGAGAAGAAGGAAGG + Intergenic
1176824756 21:13692336-13692358 CCTGCCTTGGAGAAGAAGGAAGG + Intergenic
1177328560 21:19627189-19627211 CCAGAGATGGAGAAAAAGAAAGG + Intergenic
1178350784 21:31872287-31872309 CTTGTGAGGGAGAAGGAGGAGGG - Intergenic
1178706458 21:34877572-34877594 ACTGCCAAGGAGAAAAAGGAGGG + Intronic
1180199534 21:46216035-46216057 CCTGCCATGGGGAAGAAGGAGGG - Intronic
1180857276 22:19056465-19056487 CCTGTGATGGTGAAGAGGAAGGG + Intronic
1181636905 22:24178746-24178768 CCTGAGATGCTGGAGAAGGAGGG - Intergenic
1181851832 22:25754971-25754993 CCTGGGCTGGAGAGGAAGGCGGG + Intronic
1181886029 22:26023107-26023129 GTGGTGATGGAGAAGAAGGAAGG - Intronic
1183637028 22:39070371-39070393 CCTGGGAAGGAGGAGGAGGAAGG - Intronic
1184677225 22:46050351-46050373 CCTGTGAAGGGGAAGAAGGATGG - Exonic
1184928775 22:47664054-47664076 GCTTGGTTGGAGAAGAAGGAAGG - Intergenic
1185098789 22:48826494-48826516 CCTGTGATGGAGAGAAGGGAAGG - Intronic
1185150183 22:49159793-49159815 CCTTTGATGGTGAAGCAGGAAGG - Intergenic
1185343832 22:50302890-50302912 CCTGCTTTGGAGGAGATGGAGGG - Intronic
953221764 3:40978177-40978199 CCTGGGTTGGGGGAGAAGGATGG - Intergenic
953877959 3:46677022-46677044 CCTGCGATGGGGATGGAGGGTGG + Exonic
954655363 3:52191137-52191159 CCTGATATGGAGAAGGAGCATGG - Intergenic
954864516 3:53717546-53717568 CCTACCATGGAGAAGTGGGATGG + Intronic
955015896 3:55068368-55068390 CTTCCTATAGAGAAGAAGGAAGG - Intronic
955237908 3:57156121-57156143 ACTGCAACGGGGAAGAAGGATGG + Intronic
955377636 3:58411375-58411397 GCTGCAAAGGAGAGGAAGGAGGG + Intronic
955645909 3:61137199-61137221 AGTGTGATGGGGAAGAAGGAAGG - Intronic
956778946 3:72589479-72589501 CATGAGAAGAAGAAGAAGGATGG - Intergenic
956957842 3:74361405-74361427 ACTGAGATGAAGAAGCAGGATGG - Intronic
959596704 3:108136768-108136790 CCTGCAATGCAGAAAAAGGGTGG + Intergenic
959933182 3:112004139-112004161 TCAGTGATGGAGAAGAAGTAGGG + Intronic
961832407 3:129630534-129630556 TCTACTATGGAGAAGTAGGATGG + Intergenic
961951011 3:130749080-130749102 ATTGAGATGGAGAAGAAGGGAGG - Intergenic
963060629 3:141222048-141222070 CCTGGCCTGGAGAAGAGGGAAGG - Intergenic
963308545 3:143681833-143681855 CCAGTGATGGAGAAGCAGGTGGG + Intronic
965186295 3:165468627-165468649 TCTGCAAAGGAGAAAAAGGAAGG - Intergenic
967758932 3:193202286-193202308 CCTGGGAAGGAGAAGATGGAAGG + Intergenic
968666655 4:1826012-1826034 CCCAGGATGGAAAAGAAGGAGGG + Intronic
969461371 4:7330964-7330986 CCTGCGAGGGAGAGGAATGTGGG + Intronic
971242905 4:24904820-24904842 CCTGCACTGAAGAAGAGGGATGG - Intronic
972696619 4:41452691-41452713 CTTGCGGTGCAGAAGAAGGAAGG - Intronic
974228119 4:59075241-59075263 TATGCTAAGGAGAAGAAGGAAGG + Intergenic
974510214 4:62830404-62830426 CCTAAGATGGAGAATAAGGCTGG - Intergenic
975523018 4:75320423-75320445 ACTGAGATGGGAAAGAAGGATGG - Intergenic
977146600 4:93448968-93448990 AGGGAGATGGAGAAGAAGGAAGG - Intronic
978468815 4:109038947-109038969 ACTGAGATGGAGAATAAAGATGG - Intronic
978760318 4:112350428-112350450 CCAGGGATGGAGTAGGAGGAGGG - Intronic
979239525 4:118436037-118436059 CATGGGATGGAGAGAAAGGAGGG + Intergenic
981579218 4:146235742-146235764 TCTGCGCTGGGGCAGAAGGAAGG + Intergenic
981712682 4:147724583-147724605 ACTGGGATGGGGAAGAGGGAGGG - Intergenic
982688577 4:158523006-158523028 GATGCGATGGAGCAGAGGGAAGG - Intronic
983010177 4:162537335-162537357 CCAGAGATGGAGTAGGAGGAGGG + Intergenic
983090075 4:163493085-163493107 ACTGCCATGCAGAAAAAGGAGGG - Intergenic
983378245 4:166957465-166957487 AGTGAGATGGAGAAGAATGAAGG - Intronic
985626213 5:989909-989931 CCTGGCCTGGTGAAGAAGGAAGG - Intergenic
986687882 5:10289920-10289942 CCGACGCTGGAGAGGAAGGAAGG + Intronic
986740346 5:10700230-10700252 CCAGCCATGTGGAAGAAGGAAGG - Intronic
987523883 5:19023078-19023100 TCAGAGATTGAGAAGAAGGAGGG - Intergenic
990902779 5:60771186-60771208 CCAGAGTTGGAAAAGAAGGAAGG + Intronic
994117280 5:96074704-96074726 TCTGAGATGGGGAAGAAAGAAGG + Intergenic
997065681 5:130556112-130556134 CCTGGGATGGAGACCCAGGATGG + Intergenic
997253247 5:132407613-132407635 CCTGTGAAAGAGAAGAGGGAAGG + Intergenic
998771991 5:145556315-145556337 ACTGCGATAGGGAAGAAGAATGG - Intronic
1000163756 5:158626999-158627021 CCTGAGATGGAGAAATAGGTTGG - Intergenic
1001420999 5:171587048-171587070 CCTGAGATGGAGATGAGGGAGGG - Intergenic
1001771025 5:174295878-174295900 CCAGAGATGGAGACAAAGGATGG + Intergenic
1001784087 5:174396763-174396785 CCAGCCATGGAGGTGAAGGAGGG + Intergenic
1002739774 5:181426625-181426647 CATGGGATGGAGAGAAAGGAGGG + Intergenic
1003085326 6:3055796-3055818 CCAACGATAGAGCAGAAGGAAGG + Intergenic
1004507394 6:16258159-16258181 TCAGAGATGGAGAAGAAAGATGG + Intronic
1005954322 6:30653021-30653043 CATGAGATGGAAAGGAAGGAAGG - Exonic
1007112083 6:39318738-39318760 CCAGCGAGGGACAAGAATGAGGG - Intronic
1007674805 6:43584684-43584706 CTTGTGATGGAAAGGAAGGAGGG - Intronic
1007714258 6:43845254-43845276 CCTGGAAAGGAAAAGAAGGAGGG - Intergenic
1008164628 6:48120978-48121000 CCTTCCATGAAGGAGAAGGAAGG + Intergenic
1010007676 6:71013106-71013128 CCTACGATGAACAAGAAGGTTGG - Intergenic
1013551476 6:111211844-111211866 CCAGGGATGGAGAAAAAGGAAGG - Intronic
1013745532 6:113341208-113341230 TCTGCTTTGGAGAAGATGGAAGG + Intergenic
1016376174 6:143422619-143422641 CCTGAGATGGACAAGAAGCAAGG + Intergenic
1016387232 6:143540285-143540307 CCTGAAATGGAGAAGAGGAAGGG + Intronic
1017557057 6:155583066-155583088 TCTGCCATGGGGAAGGAGGATGG + Intergenic
1017828439 6:158101084-158101106 CCAGGGATTGAGAGGAAGGAGGG - Intergenic
1017970330 6:159306832-159306854 GCTACAATGGAGAAGAAAGAGGG - Intergenic
1017981320 6:159402796-159402818 CCTGGGCTGCAGAGGAAGGATGG + Intergenic
1018035499 6:159877940-159877962 CATGGGATGGAGAAAATGGAGGG - Intergenic
1018041903 6:159932118-159932140 GCTGCGAGGGTGAAGAAGCATGG - Intergenic
1019113807 6:169740471-169740493 CCTCCGGTAAAGAAGAAGGATGG - Intronic
1019244887 6:170702211-170702233 CATGGGATGGAGAGAAAGGAGGG + Intergenic
1020409688 7:7877320-7877342 CCTGAGATGGAAAATAAGGCAGG + Exonic
1021585583 7:22203918-22203940 CCTGAAATGTAGAAGAAGAAAGG + Intronic
1021920452 7:25479947-25479969 CCTGTGATGGAGAAGAGGAGTGG + Intergenic
1024084927 7:45884989-45885011 CTTGAGATGGAGAAGCTGGAAGG + Intergenic
1024658339 7:51471321-51471343 CCTGTGAGGGAGGGGAAGGAGGG - Intergenic
1024699995 7:51896480-51896502 ACTGTGAGGGAGAAGAAGGGAGG + Intergenic
1024953628 7:54892345-54892367 CCTGGGATGGAGGAGATGGAGGG - Intergenic
1026136025 7:67661555-67661577 CAGGTGATGGAGGAGAAGGATGG - Intergenic
1026255443 7:68707276-68707298 CCTGCTAGGGAGAAGAGAGAGGG - Intergenic
1030788591 7:113694910-113694932 CCTGGGATGCAGAAGAGGGAAGG + Intergenic
1032993065 7:137415156-137415178 CCTGCGTTGAAGGACAAGGAAGG + Intronic
1033458110 7:141520700-141520722 CCTGCCATGGAGAACAGGGACGG - Intergenic
1034422863 7:150998475-150998497 CCTGCCTTGGGGAAGAAGGCTGG - Intronic
1034951807 7:155303167-155303189 CTTCCGATGGTGAAGGAGGAGGG - Intronic
1035052229 7:156005524-156005546 CCTGCGAGGGAAATGAAGCAGGG - Intergenic
1035122229 7:156578471-156578493 CCTGCCAGGGAGGAAAAGGAGGG + Intergenic
1035503236 8:105976-105998 CATGGGATGGAGAGAAAGGAGGG - Intergenic
1036620897 8:10424165-10424187 CCTGCGATGGAAAAGAGGAAAGG + Intronic
1037358195 8:18045342-18045364 CATGCCATGGAGCAGAAAGAGGG - Intergenic
1038546693 8:28431183-28431205 CCTGCCATGGTGAAAAGGGAGGG - Intronic
1041248482 8:55911851-55911873 ACTGAGATGGAGAAGATGGGAGG + Intronic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1042689461 8:71481808-71481830 CTTCTGATGGAGAAAAAGGAAGG + Intronic
1044041070 8:87368923-87368945 CATGAGAAGGAAAAGAAGGAGGG - Intronic
1044550383 8:93505558-93505580 CATGCGATGAATAAGTAGGAAGG - Intergenic
1046161161 8:110366857-110366879 GCTGCTATGAAGAAGAAGAAAGG + Intergenic
1046890516 8:119416588-119416610 CAGGAGATGGAGAAGCAGGAAGG - Exonic
1047026081 8:120826047-120826069 CATGCTATGAAGCAGAAGGAAGG - Intergenic
1048367362 8:133750221-133750243 CCTGGGGTGGGGGAGAAGGAGGG - Intergenic
1049256492 8:141616861-141616883 CCTTTGATGGGGAAGAGGGAGGG - Intergenic
1049322855 8:142006208-142006230 CCTGGGCTTGAGAAGAAGGAAGG - Intergenic
1051315590 9:15827206-15827228 CCTGCAAGGGAGAAAAAAGAAGG - Intronic
1051522385 9:18003743-18003765 CCTGCTATGAAGAAGAAGTTTGG - Intergenic
1053140676 9:35680731-35680753 CCTGCGATGGAGAGCAGAGAGGG - Exonic
1055075028 9:72205333-72205355 CCTGAGAAAGGGAAGAAGGAAGG - Intronic
1056531629 9:87493156-87493178 CATGAGATGAAGGAGAAGGAAGG - Intergenic
1057045323 9:91881817-91881839 CCTGAGATGAAGAAGGATGAGGG + Intronic
1057817138 9:98304125-98304147 CGTGGGATGGGGATGAAGGAAGG + Intronic
1058618555 9:106861051-106861073 CGTGCGGTGGAGAAGAAAGGAGG - Intergenic
1059051348 9:110930181-110930203 CATCCTATGGAGAAGAAGAAGGG - Intronic
1060183905 9:121552335-121552357 CCTGAGATGGGGAACCAGGAAGG - Intergenic
1061013306 9:127967927-127967949 CCTGGGGTGGAGAAGAAGGTAGG - Intronic
1062726273 9:138075797-138075819 CCTGCAATGGAGAAGAGCAATGG - Exonic
1203522604 Un_GL000213v1:57225-57247 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1203605080 Un_KI270748v1:51432-51454 CATGGGATGGAGAGAAAGGAGGG + Intergenic
1185550610 X:980616-980638 GCTGCCATGGAGGAGGAGGAGGG + Intergenic
1185550642 X:980720-980742 GCTGCCATGGAGGAGGAGGAGGG + Intergenic
1186962611 X:14752935-14752957 CCAGAGACAGAGAAGAAGGAAGG - Intergenic
1188866950 X:35324926-35324948 CCTGGGATTGGGAAGAAGTAGGG + Intergenic
1190035679 X:47021124-47021146 ACTGGCAGGGAGAAGAAGGAGGG - Intronic
1195971135 X:110474760-110474782 ACTGCTATGGAGAGGAATGAAGG - Intergenic
1196219924 X:113101577-113101599 CCTGGGATGCAGCAGAAGCAGGG - Intergenic
1202387267 Y:24337833-24337855 CATGGGATGGAGAGAAAGGAGGG + Intergenic
1202483519 Y:25332295-25332317 CATGGGATGGAGAGAAAGGAGGG - Intergenic