ID: 1132332083

View in Genome Browser
Species Human (GRCh38)
Location 15:101019488-101019510
Sequence CAGCTAGCTGTACTGTGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132332083_1132332091 18 Left 1132332083 15:101019488-101019510 CCCATTCACAGTACAGCTAGCTG 0: 1
1: 0
2: 0
3: 11
4: 81
Right 1132332091 15:101019529-101019551 TGGTTTTGGTATTCCATTATCGG 0: 1
1: 0
2: 2
3: 19
4: 206
1132332083_1132332087 -8 Left 1132332083 15:101019488-101019510 CCCATTCACAGTACAGCTAGCTG 0: 1
1: 0
2: 0
3: 11
4: 81
Right 1132332087 15:101019503-101019525 GCTAGCTGGGCAGATTTTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 151
1132332083_1132332089 4 Left 1132332083 15:101019488-101019510 CCCATTCACAGTACAGCTAGCTG 0: 1
1: 0
2: 0
3: 11
4: 81
Right 1132332089 15:101019515-101019537 GATTTTCCAGGCATTGGTTTTGG 0: 1
1: 0
2: 1
3: 22
4: 302
1132332083_1132332088 -2 Left 1132332083 15:101019488-101019510 CCCATTCACAGTACAGCTAGCTG 0: 1
1: 0
2: 0
3: 11
4: 81
Right 1132332088 15:101019509-101019531 TGGGCAGATTTTCCAGGCATTGG 0: 1
1: 0
2: 2
3: 30
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132332083 Original CRISPR CAGCTAGCTGTACTGTGAAT GGG (reversed) Intronic
903030331 1:20459388-20459410 CATGTAGCTCTACTGTGAGTGGG - Intergenic
911137968 1:94463008-94463030 CAACTAACTGGACTGTGAGTGGG + Intronic
917375269 1:174345852-174345874 CAGCTAGTATCACTGTGAATGGG - Intronic
920816251 1:209335304-209335326 CAGCTAGCTGTGCTGTGACCAGG + Intergenic
1071765218 10:88656381-88656403 ATCCCAGCTGTACTGTGAATGGG + Intergenic
1073165833 10:101450243-101450265 CAGTTATCTGTTTTGTGAATAGG - Intronic
1073827320 10:107339081-107339103 CAGCTAGTTGTACTGGGAAAGGG - Intergenic
1074078285 10:110149209-110149231 CAGCCAGCTGTAGTGGGAAGAGG - Intergenic
1077996880 11:7461055-7461077 CTGCTTGCTGTACTGTCAGTGGG + Intronic
1082996445 11:59259561-59259583 CAGGTAGCGGTACTTTGATTGGG - Intergenic
1087879224 11:103394880-103394902 CAGCCAGCTATCCTGTGAAATGG + Intronic
1090317918 11:125812929-125812951 CAGCTAGTATTACAGTGAATGGG - Intergenic
1091068141 11:132536409-132536431 CAGCTTCCTCTACTGTGAAATGG + Intronic
1091133302 11:133165133-133165155 CAGCTTGCTGGACTGTGGCTCGG - Intronic
1093523809 12:20082833-20082855 CAGCTAGCTGTGGTGGGACTAGG + Intergenic
1094342731 12:29430890-29430912 CAGCTAGAGGTACTGGGAAAAGG - Intronic
1096692649 12:53330558-53330580 CAGCTAGGTGAAGTGAGAATTGG + Intronic
1097645302 12:62229324-62229346 CAGCTAGCATTATAGTGAATGGG - Intronic
1100677868 12:96887521-96887543 CTGCTACCTGTACTGTAAGTTGG + Intergenic
1100883974 12:99048947-99048969 GAGCCAGCTGTACTGTATATAGG + Intronic
1102201773 12:111062436-111062458 CAGCTGCCTTTTCTGTGAATGGG - Intronic
1104387409 12:128363464-128363486 CTGTTAGCTTTACTGTGATTGGG - Intronic
1104600382 12:130149478-130149500 GAGCTAACTTTACTGAGAATTGG - Intergenic
1106120820 13:26858993-26859015 CAGTTTGCTGAGCTGTGAATTGG + Intergenic
1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG + Intronic
1108113013 13:47097525-47097547 AAGGTAACTGTACTGTGGATAGG + Intergenic
1110116347 13:71821006-71821028 CAGCTAGCTGTACTGCAAAGTGG + Intronic
1112522263 13:100106917-100106939 CATGTACCTGTACTATGAATAGG - Intronic
1113126343 13:106983532-106983554 CAGAGAGCTGTACTTTGAACTGG + Intergenic
1113176005 13:107564797-107564819 CTGCTAGCTGAACTGTAGATTGG - Intronic
1114719985 14:24871251-24871273 CACCTAGCTCTACTTTGATTGGG - Intronic
1118015206 14:61653448-61653470 CAGGTAGATGGACAGTGAATTGG - Intronic
1120429298 14:84394223-84394245 AAGATAGCTGTAATGTCAATAGG - Intergenic
1121441931 14:93954908-93954930 CAGCTGGATGTACTGGGAGTAGG - Intronic
1124034786 15:26045246-26045268 CAGCTACCTTTATTGTGAACAGG + Intergenic
1126809212 15:52383703-52383725 CAGCTTGCTGTCCTGTGCATGGG - Intronic
1130602239 15:85284032-85284054 CAGCCAGGTGTGCTGTGAACTGG + Intergenic
1131914980 15:97255169-97255191 CAGTTAGCCCTACTGTGAACTGG - Intergenic
1132332083 15:101019488-101019510 CAGCTAGCTGTACTGTGAATGGG - Intronic
1132726941 16:1343003-1343025 CAGCTGGCCGTGCTGTGAGTGGG + Exonic
1138898342 16:61237820-61237842 CAGCTCCCTGTGCTCTGAATGGG - Intergenic
1140925155 16:79575499-79575521 CAGCTATCTTTTCTGAGAATTGG + Intergenic
1143118718 17:4594662-4594684 CAGCCAGCGGGACTGTGATTGGG + Intronic
1144347551 17:14363082-14363104 TTGCTTGCTGTTCTGTGAATGGG + Intergenic
1148219044 17:45849483-45849505 CAGCTTGCTGCACTGTGCTTGGG + Intergenic
1150758595 17:67939041-67939063 GAGCTGGCAGTAGTGTGAATTGG + Intronic
1153112785 18:1612338-1612360 CTACTAGCTGTGCTGTTAATAGG + Intergenic
1156283631 18:35667776-35667798 CAGTTCCCTGTCCTGTGAATTGG + Intronic
1159607137 18:70486599-70486621 TAACTAGCTGTCCTGTGAATCGG + Intergenic
1160554143 18:79715127-79715149 CAGCTCGCTGTTCTGTGACTCGG - Exonic
1163763904 19:19151754-19151776 CAGTTTGCTCTTCTGTGAATGGG + Intronic
1166720864 19:44994957-44994979 CTGCTAGCTAGAGTGTGAATGGG - Intergenic
1167064775 19:47176665-47176687 CAGGTGGCTGAATTGTGAATGGG - Intronic
925883143 2:8369683-8369705 CAGCTGGCTGTAGTGGGAAGAGG - Intergenic
928774450 2:34742553-34742575 CAAATAGCTGTATTGTGATTTGG - Intergenic
943055319 2:182970649-182970671 CAGCTAGCAATACACTGAATTGG + Intronic
943351938 2:186806233-186806255 CAGCTAGCTGCACTGTGCTGGGG + Intergenic
1169285592 20:4304698-4304720 CAGCTAGCTGTACGCTGGCTCGG + Intergenic
1170947380 20:20903488-20903510 CAGCTAGCTGGAGGCTGAATTGG + Intergenic
1172788097 20:37483228-37483250 CAGCTGGCAGGACTGTGAAGTGG - Intergenic
1175974135 20:62701937-62701959 CAGCTTGCTGGACTGTGAACAGG - Intergenic
1182856975 22:33526495-33526517 CACCTAGCTGAAATGTGAACAGG - Intronic
955036392 3:55272328-55272350 TTGCTAGCTGCACTGTGAAGTGG + Intergenic
955447493 3:59029626-59029648 CACCCAGGAGTACTGTGAATTGG + Intronic
956837583 3:73108012-73108034 CAGCTCTCTGTACTGTGCTTTGG + Intergenic
970876601 4:20877894-20877916 CAGCTACCTCAATTGTGAATTGG + Intronic
973318895 4:48789918-48789940 CTCCTAGCTCTACTGTGAAATGG - Intergenic
982042639 4:151410224-151410246 AAGCTAGATCTGCTGTGAATGGG - Intronic
982754947 4:159206599-159206621 CAGCTAGCTGCACTGTGGAAAGG + Intronic
986632545 5:9788113-9788135 CATTTATCTGTACTGTGAAGGGG - Intergenic
990698171 5:58446082-58446104 CAGCAAGATTTACTGTGAAGAGG + Intergenic
992017350 5:72589370-72589392 CAGCTAGCTGCATTGTCAAGTGG - Intergenic
993847089 5:92957495-92957517 AAGCTGGCTGGACTGTGATTGGG + Intergenic
995040664 5:107584417-107584439 CAGCTACCTGGACTGTGCCTTGG - Intronic
1000538298 5:162506859-162506881 CAGACAACTGTACTGAGAATGGG - Intergenic
1002617615 5:180465418-180465440 CAGCAAGATTTACTGTGAAGAGG - Intergenic
1002650541 5:180689537-180689559 CAGCGAGCTGTACTTTGAAGTGG + Intergenic
1014164366 6:118206793-118206815 GAACTAGCTGTACTGTGAGCTGG + Intronic
1014542013 6:122688061-122688083 CAGCTAGCATTACACTGAATGGG - Intronic
1024576864 7:50771497-50771519 CTGCTGGCTGTACTTTGAACTGG - Intronic
1031008817 7:116502245-116502267 CAGCTGGCTCTTCTGAGAATGGG + Intronic
1033771094 7:144552939-144552961 GAGCTAGCTGTACTATTAAAGGG + Intronic
1039440980 8:37595153-37595175 CAGCTAGCTGCGCTGTGATGGGG + Intergenic
1052780566 9:32778536-32778558 CAGCTGACTGGACTGTGAATGGG + Intergenic
1055509687 9:76984201-76984223 GAGGTTGCTGAACTGTGAATAGG + Intergenic
1055604169 9:77950451-77950473 AAGGTAGCTGTATTCTGAATGGG - Intronic
1055827789 9:80347713-80347735 CAGCAAAATGTACTGTGACTGGG + Intergenic
1057060006 9:91995276-91995298 TAGCTGACGGTACTGTGAATTGG + Intergenic
1059040355 9:110808056-110808078 CTGCCAGCTGTAATGGGAATGGG - Intergenic
1060435877 9:123592628-123592650 CAGCTAGCTGTACATTTAGTGGG + Intronic
1198801376 X:140451405-140451427 CAGAGAGCTGCACTGAGAATTGG - Intergenic
1199307133 X:146279787-146279809 CAGCTAGCTGTGCTGTGCTTGGG + Intergenic
1200962982 Y:9011947-9011969 CAGCTAGCTTCACTCTCAATAGG + Intergenic