ID: 1132339549

View in Genome Browser
Species Human (GRCh38)
Location 15:101069261-101069283
Sequence ACTTGAGGTAGGGCAGGAGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 420}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132339535_1132339549 22 Left 1132339535 15:101069216-101069238 CCAGGTCTCAGATGGAATTACAC 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1132339549 15:101069261-101069283 ACTTGAGGTAGGGCAGGAGGGGG 0: 1
1: 0
2: 1
3: 49
4: 420
1132339539_1132339549 -7 Left 1132339539 15:101069245-101069267 CCCTCCGCTGGGAAGCACTTGAG 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1132339549 15:101069261-101069283 ACTTGAGGTAGGGCAGGAGGGGG 0: 1
1: 0
2: 1
3: 49
4: 420
1132339532_1132339549 28 Left 1132339532 15:101069210-101069232 CCATCCCCAGGTCTCAGATGGAA 0: 1
1: 1
2: 4
3: 35
4: 278
Right 1132339549 15:101069261-101069283 ACTTGAGGTAGGGCAGGAGGGGG 0: 1
1: 0
2: 1
3: 49
4: 420
1132339540_1132339549 -8 Left 1132339540 15:101069246-101069268 CCTCCGCTGGGAAGCACTTGAGG 0: 1
1: 0
2: 2
3: 6
4: 130
Right 1132339549 15:101069261-101069283 ACTTGAGGTAGGGCAGGAGGGGG 0: 1
1: 0
2: 1
3: 49
4: 420
1132339534_1132339549 23 Left 1132339534 15:101069215-101069237 CCCAGGTCTCAGATGGAATTACA 0: 1
1: 0
2: 1
3: 15
4: 196
Right 1132339549 15:101069261-101069283 ACTTGAGGTAGGGCAGGAGGGGG 0: 1
1: 0
2: 1
3: 49
4: 420
1132339533_1132339549 24 Left 1132339533 15:101069214-101069236 CCCCAGGTCTCAGATGGAATTAC 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1132339549 15:101069261-101069283 ACTTGAGGTAGGGCAGGAGGGGG 0: 1
1: 0
2: 1
3: 49
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132339549 Original CRISPR ACTTGAGGTAGGGCAGGAGG GGG Exonic
900001943 1:19332-19354 TCATGAGGAAGGGCAGGAGGAGG + Intergenic
900021663 1:189855-189877 TCATGAGGAAGGGCAGGAGGAGG + Intergenic
900339125 1:2179560-2179582 ACGTGGGGTTGGGCAGCAGGTGG - Intronic
901390809 1:8944933-8944955 AGTTAAGCTAGGCCAGGAGGGGG + Intergenic
901448137 1:9320392-9320414 ACGTGGGGCAGGGCAGGGGGAGG - Intronic
901693689 1:10990885-10990907 ACTTCAGGTTTGGCAGGAAGGGG + Intergenic
902450056 1:16491147-16491169 ACATGTGGGAGGGCAGGAGCAGG + Intergenic
902756704 1:18553617-18553639 ACTGGAGCTGGGGCAGGAAGGGG - Intergenic
902888800 1:19426430-19426452 ACTTGTGGTGGGGCGGGGGGGGG + Intronic
904331484 1:29760707-29760729 GTTAGAGGTAGGGCATGAGGAGG - Intergenic
904373610 1:30066172-30066194 AGTGGAGGGAGGGCTGGAGGAGG - Intergenic
904393179 1:30199164-30199186 ACCTGAGGTTGGGCAGGGGTGGG + Intergenic
905357328 1:37393892-37393914 CCTTGAAGCAGGGCAGGAGTGGG + Intergenic
905798657 1:40829689-40829711 ACCTGAAGTGGGGCAGGAGTTGG - Intronic
906270377 1:44473077-44473099 ACACTAGGCAGGGCAGGAGGAGG + Intronic
907327822 1:53652392-53652414 CCTTCAGGTATGGCAGGTGGAGG - Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
907859524 1:58338283-58338305 AGGTGAGGGAGAGCAGGAGGAGG - Intronic
908255250 1:62297992-62298014 TCTCTAGGCAGGGCAGGAGGAGG + Intronic
912903817 1:113681998-113682020 GGGTGGGGTAGGGCAGGAGGTGG - Intronic
913353488 1:117890172-117890194 ACTGGTGGTGGGGAAGGAGGTGG + Intronic
914986042 1:152457887-152457909 AACTGAGGTAGGGCTGGAGGGGG + Intergenic
915314707 1:155021821-155021843 AGTGGAGGTTGGGCAGGAGCAGG - Intronic
915952487 1:160198755-160198777 ACTGGAGGGAAGGCAGGGGGAGG + Intronic
915982057 1:160426423-160426445 ACTTAAGGCAGGGGATGAGGAGG - Exonic
916201511 1:162275907-162275929 AAATGAGGTAAGGCAGGAGTTGG + Intronic
916713995 1:167434909-167434931 GCTGGAGGAAGGGCTGGAGGAGG - Intronic
916714017 1:167434971-167434993 GCTGGAGGAAGGGCTGGAGGAGG - Intronic
916714030 1:167435008-167435030 GCTGGAGGAAGGGCTGGAGGAGG - Intronic
916714043 1:167435045-167435067 GCTGGAGGAAGGGCTGGAGGAGG - Intronic
916714056 1:167435082-167435104 GCTGGAGGTAGGGCTGGAGGAGG - Intronic
916714069 1:167435119-167435141 GCTGGAGGAAGGGCTGGAGGAGG - Intronic
916714082 1:167435156-167435178 GCTGGAGGAAGGGCTGGAGGAGG - Intronic
916714095 1:167435193-167435215 GCTGGAGGAAGGGCTGGAGGAGG - Intronic
916714108 1:167435230-167435252 GCTGGAGGAAGGGCTGGAGGAGG - Intronic
916714121 1:167435267-167435289 GCTGGAGGAAGGGCTGGAGGAGG - Intronic
916714133 1:167435304-167435326 GCTGGAGGAAGGGCTGGAGGAGG - Intronic
916731822 1:167573355-167573377 ACCTTATGGAGGGCAGGAGGGGG + Intergenic
917707540 1:177649338-177649360 ACTTGAGGGAGGGGAGGCTGCGG + Intergenic
918070474 1:181130395-181130417 CCTTGAGGAAGGGCAGGCTGCGG + Intergenic
920053169 1:203175525-203175547 ACTGAAGGTGGGGCAGGGGGAGG - Intronic
920092794 1:203466059-203466081 GCTTGTGGTGGGGCAGGAGTCGG + Intergenic
920774150 1:208919806-208919828 ACTTGAATGAAGGCAGGAGGTGG + Intergenic
920860125 1:209699105-209699127 ACAGGAGGAAGGGAAGGAGGAGG + Intronic
920962590 1:210676843-210676865 AGTTTAGGTAGGGGAGGGGGTGG + Intergenic
921207001 1:212858025-212858047 ACCTGAGGGTGGGCGGGAGGCGG - Intergenic
921389470 1:214604167-214604189 GGTGGAGGTGGGGCAGGAGGAGG + Intronic
921500886 1:215901541-215901563 AATTGAGTAAGGGCAGGAGAAGG - Intronic
921945371 1:220882497-220882519 ACTTGAGGCAGGAGAAGAGGAGG + Intronic
922211513 1:223490259-223490281 GCCAGAGGTGGGGCAGGAGGTGG - Intergenic
922212666 1:223497679-223497701 ATTAGCGGTAGGGGAGGAGGTGG - Intergenic
922818338 1:228467200-228467222 ACTTGGAGTGGGACAGGAGGTGG + Intergenic
923462092 1:234216348-234216370 ACTGGAAGTGGGGCAGGACGCGG + Intronic
924525564 1:244844679-244844701 ACCCGAGGTGGGGCAGGCGGAGG + Exonic
924957537 1:248944279-248944301 ACTTTAAGTGGTGCAGGAGGTGG + Intergenic
1063058382 10:2526106-2526128 CCTTGCAGTAGGGCAGGAGGTGG - Intergenic
1063199629 10:3775528-3775550 AGCTGTGGTAGGGCAGGACGTGG - Intergenic
1063643922 10:7859547-7859569 ACATGAGGTAGGAATGGAGGAGG - Intronic
1064030077 10:11877932-11877954 ATTTGTGACAGGGCAGGAGGGGG - Intergenic
1064316587 10:14263312-14263334 ACTTCAGCCAGCGCAGGAGGGGG + Intronic
1066404315 10:35104527-35104549 CCTTGGTGTAGGGAAGGAGGTGG + Intergenic
1067090827 10:43265142-43265164 ACTGCAGGCAGGGGAGGAGGAGG - Intronic
1067437279 10:46287128-46287150 ACTGGTGAAAGGGCAGGAGGAGG + Exonic
1067554506 10:47259126-47259148 AGTTGAAGAAGGACAGGAGGAGG + Intergenic
1068424208 10:56836220-56836242 ACTTGAGGTATCTAAGGAGGAGG + Intergenic
1068459330 10:57306728-57306750 ACCTGAAGTGGAGCAGGAGGTGG - Intergenic
1069853663 10:71426490-71426512 ACTTCAGGTGAGGCAGGAGGGGG + Intronic
1070284395 10:75072712-75072734 ACAGGAGGAAGGGCACGAGGAGG - Intergenic
1070513173 10:77179446-77179468 ACTGGAGGTGGGCAAGGAGGAGG + Intronic
1070797482 10:79225054-79225076 GCTTGAGGTCGGGGAGCAGGTGG + Intronic
1071501648 10:86208339-86208361 ACTGGAGCTGGGGTAGGAGGGGG - Intronic
1072758328 10:98035873-98035895 TCATGGGGTAGGGCAGCAGGAGG - Intergenic
1073062408 10:100740508-100740530 TGCTAAGGTAGGGCAGGAGGTGG - Intronic
1073467626 10:103703460-103703482 ACACTAGGCAGGGCAGGAGGGGG - Intronic
1074995692 10:118755228-118755250 ACGTGAGGCCGGGCAGGGGGCGG - Exonic
1075083129 10:119397059-119397081 ATTTGTGGTAGGGCAGATGGAGG + Intronic
1075700588 10:124467190-124467212 GCTGGCAGTAGGGCAGGAGGTGG + Intronic
1076963382 10:133785797-133785819 ACTTTAAGTGGTGCAGGAGGCGG + Intergenic
1077192873 11:1262787-1262809 ACAGGAGGTGGGACAGGAGGCGG - Intergenic
1077360110 11:2137119-2137141 GCCTGAGGCAGGGCAGCAGGGGG - Intronic
1078055172 11:8003390-8003412 ACTCCAGGTCGGGCAGGTGGTGG - Intergenic
1078059646 11:8034796-8034818 ACCTGACGGAGGGCAGGAGGTGG + Intronic
1078105119 11:8353605-8353627 ACTTAAGGTGGGGAAAGAGGAGG - Intergenic
1079094426 11:17501585-17501607 GCTTGGGGTAGGGCTGGAAGGGG + Intronic
1081593966 11:44446576-44446598 ACTGGAGGTAGTGCCGGAGCTGG + Intergenic
1081667045 11:44922727-44922749 ATTGGAGGAGGGGCAGGAGGAGG + Intronic
1081736749 11:45409672-45409694 AGGTGAGGTAGGGCTGGAGGAGG - Intergenic
1084148276 11:67276317-67276339 GCTTGAGGTGGGCCAGGAGAGGG + Intronic
1084488624 11:69465577-69465599 ACTGGAAGGAGGGCAGGAGCGGG - Intergenic
1084556374 11:69878627-69878649 AGTGGAGGGAGGGCTGGAGGAGG + Intergenic
1084583526 11:70039664-70039686 ACTTGAGGTGGAGGGGGAGGTGG - Intergenic
1084773491 11:71359538-71359560 AGTTGAGGTCGGGTAGAAGGGGG - Intergenic
1084985719 11:72869365-72869387 ACTTGAAGCAGGGCAAGAGAAGG + Intronic
1085420181 11:76351133-76351155 ACTTGATGTCAGGCAGGTGGAGG + Exonic
1085724994 11:78947410-78947432 GCTTGAGGTAGGGAGTGAGGTGG + Intronic
1086415931 11:86588948-86588970 AGGTGAGGGAGGGCAGGGGGAGG - Intronic
1087649313 11:100846500-100846522 AGTGGGGGTAGGGTAGGAGGTGG - Intronic
1088401826 11:109429786-109429808 AATTGAGGTGGAGGAGGAGGTGG - Intergenic
1089654307 11:119935748-119935770 ACTTGGGGTAGGACAAGGGGAGG - Intergenic
1090193875 11:124799453-124799475 GATTGAGGAAGGGCAGAAGGGGG - Intronic
1090367887 11:126223084-126223106 ACTTGAGGTGGGGCGGGGGAGGG + Intronic
1090439783 11:126715988-126716010 GCATGAGGTTGGGCAGGAGAAGG + Intronic
1091282429 11:134389730-134389752 ACGTGAGCTGGGGCAGGAGCAGG - Exonic
1091583897 12:1805203-1805225 TCTGGAGGGAGGCCAGGAGGAGG + Intronic
1092123520 12:6060496-6060518 GTTTGAGTTGGGGCAGGAGGTGG - Intronic
1092844059 12:12567755-12567777 ACTTGGGGTAGGGGTGAAGGTGG + Intergenic
1092846771 12:12591010-12591032 GCTTGAACTAGGGCAGTAGGTGG - Intergenic
1093241795 12:16685974-16685996 GATTGAGGAAGGGAAGGAGGAGG - Intergenic
1095958803 12:47820836-47820858 AGCTGAGGGAGGGCTGGAGGCGG - Intronic
1096253940 12:50051504-50051526 ACTTGAGGGGGTGCAAGAGGAGG + Intergenic
1096828133 12:54294847-54294869 ACGGGAGGGAGAGCAGGAGGTGG + Intronic
1096840291 12:54375767-54375789 ACTTGAGGGAGGGCAGAGGCTGG - Intronic
1097059490 12:56272018-56272040 TCTTGAGGCAGGGGACGAGGAGG + Exonic
1100543486 12:95579741-95579763 ACTTGAGGAGGGTCTGGAGGAGG + Intergenic
1100822242 12:98442355-98442377 GCTTGAAGTAGGAAAGGAGGAGG - Intergenic
1100822534 12:98444814-98444836 GCTTGAAGTAGGAAAGGAGGAGG - Intergenic
1101000963 12:100356926-100356948 AGCTGGGGTGGGGCAGGAGGGGG + Intergenic
1101962171 12:109258606-109258628 AACAGAGGCAGGGCAGGAGGTGG - Intronic
1102227654 12:111240334-111240356 ACTAGAGAGAGGGCTGGAGGGGG - Intronic
1102251458 12:111390147-111390169 ACTTGAGGCAGGGGATGAGCCGG - Intergenic
1102964541 12:117115707-117115729 ACTTGAGCTCGGGGAGGTGGAGG - Intergenic
1103024440 12:117562255-117562277 ACATGAGGAAGGGGAGGGGGTGG + Intronic
1104891680 12:132143257-132143279 ACCTTAGGTAGGGCAGGTGGAGG - Intronic
1104984169 12:132587307-132587329 ACTGGAGGGAGGGCAGCAGCTGG + Intergenic
1105306271 13:19171237-19171259 ACTGGAGCCAGGGCAGGAGTGGG - Intergenic
1106371466 13:29137968-29137990 ACTTCAGGATGAGCAGGAGGGGG + Intronic
1106381968 13:29248239-29248261 ACTTGGGGAAGGGTGGGAGGGGG + Intronic
1107037613 13:35917706-35917728 ACTTGAGGCATGGTAGGTGGGGG - Intronic
1107157491 13:37186432-37186454 GCCTGAGGTAGGGCTTGAGGAGG + Intergenic
1107839879 13:44446349-44446371 ACTTGGGGTAGGGGAGGGAGGGG + Intronic
1107885613 13:44872212-44872234 ACTCTGGGTAGGGCAGGAGGAGG + Intergenic
1109025171 13:57146300-57146322 ACTTGGGGTGGGGCGGGGGGGGG - Intronic
1110354373 13:74550232-74550254 ACTAGAGGAAGGGAAGGATGTGG + Intergenic
1110418829 13:75281435-75281457 ACTTGGGAAAGGGTAGGAGGAGG - Intergenic
1111119870 13:83832778-83832800 ACAGGAGCTAGAGCAGGAGGAGG + Intergenic
1111791287 13:92858652-92858674 AAAAGAGGGAGGGCAGGAGGAGG + Intronic
1111855691 13:93634310-93634332 AGTTGAGGACAGGCAGGAGGTGG - Intronic
1112040499 13:95542315-95542337 ACAGGAGTTAGGGCAGGTGGAGG + Intronic
1112214660 13:97417902-97417924 TGTTGAGGGAGGGGAGGAGGTGG - Intergenic
1112736290 13:102423109-102423131 ACTTGAGGGAGGACGGGGGGAGG + Intergenic
1114265886 14:21072304-21072326 ACTTGTGGGAAGGGAGGAGGAGG - Intronic
1114290080 14:21280721-21280743 TCTTGAACTAGGGAAGGAGGGGG - Intergenic
1116116743 14:40662357-40662379 ACTTGAGGGTGGGCTGGGGGAGG - Intergenic
1119195453 14:72714153-72714175 ACAGGAGGCATGGCAGGAGGTGG + Intronic
1119261100 14:73238244-73238266 CCTTGAGCTAGGGCCGAAGGCGG - Intronic
1119762684 14:77163093-77163115 TCTTGAGGGAAGGTAGGAGGAGG - Intronic
1119769700 14:77212840-77212862 GCTTGGAGTTGGGCAGGAGGTGG - Intronic
1120873920 14:89361045-89361067 GCTGGAGGTAGTGCTGGAGGTGG - Intronic
1120873949 14:89361150-89361172 GCTGGAGGTAGTGCTGGAGGTGG - Intronic
1121325431 14:93016919-93016941 TCTGGAGATGGGGCAGGAGGAGG + Intronic
1122954899 14:105066052-105066074 GGTTGAGGTAGGGCTGGGGGAGG - Intergenic
1124824982 15:33084709-33084731 CCTTGGGGAATGGCAGGAGGTGG - Intronic
1125695165 15:41630195-41630217 GTTTGAGGCAGGGCAGCAGGAGG - Intronic
1126250939 15:46566782-46566804 CATTGAGGTTGGGCGGGAGGAGG + Intergenic
1126960473 15:53988189-53988211 ATTTTAGGTATGGGAGGAGGAGG + Intergenic
1127436840 15:58966282-58966304 ACTTGAGCCAGGGCAGGTAGAGG + Intronic
1127784175 15:62341776-62341798 ATTTGAGGCAGGGCAGGAAGTGG + Intergenic
1128229795 15:66026435-66026457 AATTGAGGCAGTGCAGGATGTGG + Intronic
1128514510 15:68333977-68333999 ACTTGAGGGATGGCAGGGGATGG - Intronic
1129357002 15:74997906-74997928 ATTGGAGGTAGAGCAGGAGGGGG + Intronic
1129656679 15:77529284-77529306 ACTTGAGGGAAGGCAGTGGGAGG + Intergenic
1129820271 15:78596550-78596572 CCTTGTGTCAGGGCAGGAGGAGG - Exonic
1129858678 15:78843454-78843476 ACTGGACGTGGGGCAGGTGGAGG + Intronic
1130366363 15:83243447-83243469 ATTGGAGGTAGGGCGGGAGGAGG - Intergenic
1130981423 15:88814369-88814391 ACTTCAGTTTGGGCAAGAGGAGG - Intronic
1130995584 15:88902022-88902044 CATTGAAGGAGGGCAGGAGGTGG - Intronic
1131749181 15:95487538-95487560 ATTTGAGGCAGGGGACGAGGAGG + Intergenic
1131951279 15:97683975-97683997 AGTTGGGGTGGGGCTGGAGGGGG + Intergenic
1132069778 15:98766006-98766028 ACCTGGGTTAGGGCAGGAGGAGG + Intronic
1132339549 15:101069261-101069283 ACTTGAGGTAGGGCAGGAGGGGG + Exonic
1132451567 15:101971607-101971629 TCATGAGGAAGGGCAGGAGGAGG - Intergenic
1132455323 16:19021-19043 TCATGAGGAAGGGCAGGAGGAGG + Exonic
1132589126 16:718743-718765 ACCTGAGGAGGGGCAGAAGGTGG - Exonic
1132642956 16:986140-986162 CCTTGAGGGCAGGCAGGAGGTGG + Exonic
1133443192 16:5837541-5837563 CCTTGTGTTGGGGCAGGAGGAGG + Intergenic
1135084472 16:19464031-19464053 ACTTGGGGTAGGGGAAGTGGAGG - Intronic
1138239449 16:55415359-55415381 GCTTGAGCCAGGGAAGGAGGAGG - Intronic
1138491017 16:57376673-57376695 AATAGGGGTTGGGCAGGAGGTGG + Intronic
1138858822 16:60729935-60729957 CCTTCAGGTAGAGCAGGGGGCGG + Intergenic
1139261164 16:65595650-65595672 GCTTGAAGTAGGGCAGAAGAAGG + Intergenic
1140936934 16:79680850-79680872 ACTTGAGGTTGGACAGTGGGAGG + Intergenic
1141567590 16:84913655-84913677 ACCTGAGCCAGGGGAGGAGGAGG - Intronic
1142826085 17:2512027-2512049 CTTTGAGGTATGGCAGGAGGAGG + Intergenic
1143855361 17:9844157-9844179 AGGTGAGGTAGGGCCTGAGGAGG + Intronic
1143860739 17:9888916-9888938 ACTTGTAGTAGGGCGAGAGGAGG - Intronic
1144531418 17:16042745-16042767 AACTGTGGTAGGGAAGGAGGAGG + Intronic
1145214465 17:21042044-21042066 ACGGGAGCTGGGGCAGGAGGCGG - Intronic
1146492110 17:33291079-33291101 AGTTGAGGTCGGGAAGAAGGAGG + Intronic
1146683630 17:34825930-34825952 AATTTAGGAAGGGCAGCAGGTGG - Intergenic
1147305850 17:39563959-39563981 ACTTGAGGTCGAGGAGGATGGGG + Intronic
1147578882 17:41617628-41617650 ACCTGAGGTGGGGCAGGAGGTGG + Intergenic
1148856723 17:50582989-50583011 GCTGGGGGTGGGGCAGGAGGAGG + Intronic
1149030559 17:52078251-52078273 AGTTGAGGTAGGGAAGGAAATGG + Intronic
1149083869 17:52691019-52691041 TTTGGAGGTAGGGAAGGAGGGGG + Intergenic
1150874351 17:68952591-68952613 ACTTGGGCTTGTGCAGGAGGTGG + Intronic
1151384297 17:73745744-73745766 ACTTCAGTTAGGGAAGGTGGAGG - Intergenic
1151396533 17:73826757-73826779 CCTTGAAGCAGGGCAGGTGGGGG + Intergenic
1152017953 17:77764263-77764285 GGTTGGGGTAGGGCAGGAGCTGG + Intergenic
1152387914 17:79986188-79986210 GCGGGAGGGAGGGCAGGAGGCGG + Intronic
1152424340 17:80210787-80210809 AGTTGAGGTTGTGCACGAGGCGG + Exonic
1152492853 17:80649424-80649446 AGGTGAGTTTGGGCAGGAGGAGG - Intronic
1153526453 18:5999083-5999105 ACTTGTGGTGAGGCAGTAGGTGG - Intronic
1153732589 18:8029406-8029428 ACTCCAGGTAGGACAGGTGGGGG - Intronic
1154216440 18:12419978-12420000 ACTGGAGGTGGGGCAAGAGGAGG + Intronic
1154998813 18:21666821-21666843 ACTTGAGATCTGGGAGGAGGGGG + Intronic
1157581471 18:48776487-48776509 ACTTGAGGGAGGGGAGGAAAAGG - Intronic
1160633695 19:60940-60962 TCATGAGGAAGGGCAGGAGGAGG + Intergenic
1160653616 19:247459-247481 ACTTTAAGTGGTGCAGGAGGCGG - Intergenic
1162648130 19:12064908-12064930 ACTTGGGGGAGGGTAGGCGGAGG + Intronic
1162754899 19:12852094-12852116 TCCTGAGGCAGGGCAGGAGTGGG - Exonic
1162787299 19:13043710-13043732 ACTTGGGGCAGGGCACAAGGGGG - Intronic
1163281951 19:16323872-16323894 TATTGAGGTTGGGGAGGAGGGGG + Intergenic
1163828716 19:19537726-19537748 ACTTCAGCTAGGGCTGGGGGCGG + Intergenic
1165330390 19:35138710-35138732 ACTGGAGCTGGGGCTGGAGGGGG - Intronic
1165419460 19:35715810-35715832 ACCTGGGGTAGGGCTGGAGGAGG - Exonic
1165797585 19:38527886-38527908 TTTTGGGGCAGGGCAGGAGGTGG + Intronic
1166239310 19:41478952-41478974 ACTGGATCTAGGGAAGGAGGAGG - Intergenic
1166762906 19:45235754-45235776 ACTGGAGGGAGGTGAGGAGGGGG - Intronic
1167492138 19:49799053-49799075 CTTTTAGGTAGGGTAGGAGGAGG + Intronic
1167621335 19:50562686-50562708 GAGTGAGGCAGGGCAGGAGGGGG - Intronic
1168261355 19:55196839-55196861 ACTGGGGGTAGGGGTGGAGGGGG - Intronic
1168274003 19:55266098-55266120 CCTTGAGTGAGGGCAGGAGTGGG - Intronic
1168315510 19:55483227-55483249 CCTGGAGGTGGGGCAGGACGTGG - Exonic
1168422440 19:56213417-56213439 ACATGAGGTGGGGAAGGAGGTGG + Intergenic
1168543803 19:57233602-57233624 CCCTGAGGTAGGTCAGGTGGTGG + Exonic
1168728517 19:58606246-58606268 ACTTTAAGTGGTGCAGGAGGCGG + Intergenic
926263811 2:11294868-11294890 ACTTGAGGTGGAGGAGGAGGTGG - Intronic
926801496 2:16664621-16664643 ACTTGTGCTGGGGCAGCAGGAGG - Intronic
926908426 2:17827346-17827368 CCTTGAGGGAGGGAAGGTGGAGG + Intergenic
929032097 2:37658692-37658714 ACTTGATGTAGAGATGGAGGCGG - Intronic
929615449 2:43303720-43303742 ACTTTAGGTGGGGCCGGGGGTGG + Intronic
930355915 2:50319890-50319912 ACTTGAGTTAGAACTGGAGGAGG - Intronic
930722300 2:54649197-54649219 ACTTGAGGCAGTGCATGAGTTGG + Intronic
933771274 2:85745814-85745836 GCTTGCGGTGGGGCGGGAGGGGG + Intergenic
934116523 2:88802210-88802232 AGCTGAGTCAGGGCAGGAGGTGG + Intergenic
934646210 2:96060613-96060635 GTTTGAGGAGGGGCAGGAGGAGG - Intergenic
935330975 2:101977994-101978016 AAGGGTGGTAGGGCAGGAGGGGG + Intergenic
935761290 2:106322955-106322977 CCTTGGGGAGGGGCAGGAGGAGG + Intergenic
936567779 2:113594073-113594095 TCATGAGGAAGGGCAGGAGGAGG - Intergenic
936569986 2:113604453-113604475 ACTTTAAGTGGTGCAGGAGGTGG - Intergenic
937379151 2:121360801-121360823 ACTTGTGGTAGAGCTGGTGGAGG - Intronic
939991125 2:148876946-148876968 ACTGGAGGAAGGGGAGGAGGGGG - Intronic
940580919 2:155578944-155578966 ACTAGAGGCAGGGAAGGAGAAGG + Intergenic
941068790 2:160932724-160932746 ACTTGTGGTGGGGAAGGAGGGGG + Intergenic
943456077 2:188108843-188108865 ACTTGAGGTTGGAGAGTAGGAGG + Intergenic
943981274 2:194554398-194554420 ACTTGAGGTATGGAATGAGAAGG + Intergenic
944689850 2:202149138-202149160 ACTGGGGGTAGGGGAGAAGGAGG - Intronic
945572418 2:211485464-211485486 ACTTGAGCTGGGCCAGAAGGAGG - Intronic
946025771 2:216670898-216670920 AGTGGAGGTAGAGGAGGAGGAGG - Intergenic
946246640 2:218391489-218391511 GATGGAGGTAGGGCAGGGGGCGG + Exonic
946374552 2:219300164-219300186 ACTGGAGGTAGGGCTGGCAGTGG + Exonic
947165749 2:227260127-227260149 ATTTGCTGGAGGGCAGGAGGAGG + Intronic
947748813 2:232522593-232522615 CCTTGGGGTGGGGCAGGATGCGG - Exonic
948155829 2:235780119-235780141 ACAGGAGGTAGGGGTGGAGGTGG - Intronic
949088774 2:242181888-242181910 ACTTTAAGTGGTGCAGGAGGCGG + Intergenic
1168813080 20:719100-719122 CCTTGAGGTGGGGCAGGATGAGG + Intergenic
1169064388 20:2686125-2686147 CCTTGAGGTAGAGCAGGGTGCGG - Intergenic
1171099073 20:22365442-22365464 GGATGAGGAAGGGCAGGAGGCGG - Intergenic
1172781012 20:37437128-37437150 ATTAGAGGTAGGGCAGGGAGAGG - Intergenic
1173246387 20:41340667-41340689 TCTGGAGGTGGGGCAGGCGGTGG + Intergenic
1173506023 20:43587804-43587826 ACTTGAGGAAGGGAAAGAGTGGG - Intronic
1173926872 20:46787326-46787348 ATGTGAGCCAGGGCAGGAGGGGG - Intergenic
1174137080 20:48387101-48387123 ACTTGGGGAATGGCAGGAGCAGG - Intergenic
1174597027 20:51692476-51692498 ACGTGAAGTGGGGCTGGAGGGGG + Intronic
1174769959 20:53290209-53290231 GCTTGGGGTAGGGTAGTAGGAGG - Intronic
1175098391 20:56560207-56560229 ACTTGAGCCTGGGGAGGAGGAGG - Intergenic
1175234801 20:57502465-57502487 TCTTGAGGAAAGGCAGGTGGAGG + Intronic
1175307695 20:57988550-57988572 AGTAGAGGAAGGGGAGGAGGAGG - Intergenic
1175348741 20:58302608-58302630 ATTTGAGTTGGGGCAGGCGGAGG - Intergenic
1175440570 20:58988193-58988215 AGATGGGGTAGGGCTGGAGGAGG + Intronic
1175467155 20:59197197-59197219 GATAGAGGCAGGGCAGGAGGGGG - Intronic
1175570840 20:60020386-60020408 ACTTGGGGTAGGGCATGCAGTGG + Intronic
1175942202 20:62542640-62542662 CCCTGAGGTTGGGCAGGAGGCGG + Intergenic
1178935870 21:36861246-36861268 TCTTGTGGTAGGGGAGGAAGGGG - Intronic
1179434275 21:41349669-41349691 ACCTGAGGTAGAGGAGAAGGGGG + Intronic
1179474222 21:41633076-41633098 TCTTGAGCTAGGTCAGAAGGAGG - Intergenic
1179812038 21:43877954-43877976 GCTGGTGGTGGGGCAGGAGGCGG - Intronic
1180098547 21:45573412-45573434 ACCTGGGGTAGGGCAGGGGGTGG + Intergenic
1180263997 21:46698170-46698192 ACTTTAAGTGGTGCAGGAGGTGG + Intergenic
1180825499 22:18858221-18858243 CCTTGGGGTTGGACAGGAGGTGG - Intronic
1180933677 22:19610398-19610420 ACATGAGGAGGGGCAGGAGTTGG - Intergenic
1181187233 22:21116326-21116348 CCTTGGGGTTGGACAGGAGGTGG + Intergenic
1181211965 22:21294167-21294189 CCTTGGGGTTGGACAGGAGGTGG - Intergenic
1181500282 22:23312094-23312116 CCTTGGGGTTGGACAGGAGGTGG + Intronic
1181613220 22:24033587-24033609 ACGTCAGGGAGGGCAGGAGGAGG - Intronic
1182513295 22:30835798-30835820 ACTTGAGATAGGGGAGGTCGAGG - Intronic
1182696613 22:32203012-32203034 ACTTGAGCAAGAACAGGAGGAGG + Exonic
1182984733 22:34705735-34705757 ACATGAGTCAGGGCAGGAGCAGG + Intergenic
1183544220 22:38447136-38447158 CCTTGGGGTAGGGGAGGGGGAGG + Intronic
1184925137 22:47631262-47631284 ACTTGCGGTAGGGAAGGCAGGGG + Intergenic
1185122510 22:48980820-48980842 CCGGGAGGTAGGGCAGGACGAGG - Intergenic
1185430230 22:50806527-50806549 ACTTTAAGTGGTGCAGGAGGTGG + Intergenic
1203214989 22_KI270731v1_random:1265-1287 CCTTGGGGTTGGACAGGAGGTGG + Intergenic
950708139 3:14796461-14796483 AGTTGAGGGAGAGGAGGAGGTGG - Intergenic
953617340 3:44503020-44503042 ACTTGAGGAAGGGTAGGAACTGG + Exonic
953625560 3:44567926-44567948 ACTTGAGGAAGGGTAGGAACTGG - Exonic
955275000 3:57538938-57538960 AATTGAGGAAGTCCAGGAGGTGG - Intronic
955550724 3:60082116-60082138 ACTAGTGGGAGGGAAGGAGGGGG - Intronic
955603616 3:60674888-60674910 GCATGAGGTAGGGCATGTGGAGG - Intronic
957478638 3:80760713-80760735 GCTTGTGGCAGGACAGGAGGGGG - Intergenic
957865270 3:86014831-86014853 ACTTGATGTCAGGCAGGTGGAGG - Intronic
959908898 3:111740739-111740761 ACTTAAGGTAGGCTAGGAAGAGG + Intronic
960629231 3:119712142-119712164 GTTTGAGGTTGGGGAGGAGGTGG + Intronic
961456495 3:127027219-127027241 CCCTGAGGTGGGACAGGAGGCGG + Intronic
961569743 3:127789133-127789155 ATTAAAGGTGGGGCAGGAGGGGG + Intronic
961705661 3:128783249-128783271 AGTGGGGGTAGGGCAGGAGGAGG - Intronic
963146850 3:142002967-142002989 ACATGAAGTGGGGCAGAAGGGGG + Intronic
963475361 3:145796921-145796943 AGATGAGGGAGGGAAGGAGGAGG + Intergenic
964197042 3:154077017-154077039 ACTAGAGGAAGGACAGCAGGAGG + Intergenic
964437347 3:156668263-156668285 ACTTGGGGGTGGGGAGGAGGTGG - Intergenic
965751517 3:171979437-171979459 ACTGGAGGTCGGGCAGGGAGAGG - Intergenic
966173865 3:177114391-177114413 ACTTGGGGTTGGGGAGGTGGAGG - Intronic
967304492 3:188047427-188047449 ACATGATATCGGGCAGGAGGTGG + Intergenic
967835793 3:193961163-193961185 ACTTGGGGTAGGGGAGGACGTGG + Intergenic
968373047 4:12427-12449 ACTTTAAGTGGTGCAGGAGGCGG - Intergenic
968569379 4:1331477-1331499 ACTGGAGTTAGTGTAGGAGGTGG - Intronic
968811050 4:2799810-2799832 CCTTGAGGGGGAGCAGGAGGAGG + Intronic
968880473 4:3296136-3296158 AATGGAGGCAGGGCAGGAGCCGG - Intronic
969106699 4:4811860-4811882 ACAAGAGCTGGGGCAGGAGGAGG - Intergenic
969479771 4:7441673-7441695 ACCTGGGCTGGGGCAGGAGGTGG - Intronic
969597186 4:8156194-8156216 ACCTGAGCTGGGGCAGGGGGTGG - Intronic
969600184 4:8171502-8171524 GCTTGAGGCAGGGAAGGAGCAGG + Intergenic
971689568 4:29815398-29815420 TAGTGAGATAGGGCAGGAGGAGG + Intergenic
972000373 4:34024304-34024326 ACATGAAGTAGGGGGGGAGGTGG + Intergenic
972326133 4:38016904-38016926 ACTTGGGGGAGGGCAAGAGTAGG + Intronic
973152067 4:46900486-46900508 ACTGGTGGCAGGGGAGGAGGGGG + Intronic
974703632 4:65483532-65483554 ACGTTAGGGAGGGAAGGAGGTGG + Intronic
975633076 4:76421240-76421262 AGTTGGGGGAGGGGAGGAGGGGG + Intronic
979896896 4:126169876-126169898 AATTGCGGGAGGGCTGGAGGGGG + Intergenic
980509236 4:133762833-133762855 AGTTAAGGTAGGGGATGAGGAGG + Intergenic
980823420 4:138045130-138045152 ACTTTATGCAGGGCAGGAGCTGG - Intergenic
980874090 4:138643219-138643241 ACATGGAGTAAGGCAGGAGGAGG + Intergenic
984881264 4:184411826-184411848 AGTTGAGCCAGGGCAGGAGTGGG - Intronic
985462348 4:190120140-190120162 ACTTTAAGTGGTGCAGGAGGCGG + Intergenic
985466605 4:190203095-190203117 ACTTTAAGTGGTGCAGGAGGCGG + Intergenic
986851760 5:11820779-11820801 ACTTCAGGTACTGCAGGATGTGG + Intronic
988424348 5:31046053-31046075 ACATGGGGTAGGGAAGGATGAGG - Intergenic
989192892 5:38688716-38688738 AGTAGGGGTTGGGCAGGAGGTGG - Intergenic
990288874 5:54328717-54328739 AATTTAGGTAGGGCAGCAAGTGG - Intergenic
990654444 5:57939612-57939634 AAGTGAGGGAGGGAAGGAGGGGG - Intergenic
993391553 5:87324730-87324752 ACTTGAGGAAGGGGAGAAGAGGG - Intronic
996576084 5:124977563-124977585 AGTAGAGGTAGGGGAGGAAGGGG + Intergenic
997014220 5:129912422-129912444 ACCTGAGGTACACCAGGAGGAGG - Intronic
997600868 5:135137504-135137526 GCTTGGGATAGGGCAGGATGGGG + Intronic
997629592 5:135356680-135356702 ATTTAGGGCAGGGCAGGAGGCGG + Intronic
997756558 5:136405184-136405206 CCTCGAGGGAGGGAAGGAGGAGG - Intergenic
997871913 5:137513914-137513936 GGCTGAGGGAGGGCAGGAGGGGG - Intronic
998158391 5:139799213-139799235 TCTGGAGGTAGGGAAGGGGGAGG - Intronic
998535993 5:142931192-142931214 ATTTGAGGGAGAGGAGGAGGTGG + Intronic
999915145 5:156250494-156250516 ATTAGTGGTAGGGCAGGAGCTGG - Intronic
1000654470 5:163859625-163859647 ACTTGAGATAGGACAGATGGTGG + Intergenic
1001433079 5:171678733-171678755 AATTGAGGTAGGGGAGGGTGGGG - Intergenic
1002561389 5:180084518-180084540 ACCTGAAGTAGGGCAGGTTGTGG + Intergenic
1003307635 6:4944246-4944268 CCTTGAAATAGGGCAGGAGGTGG + Intronic
1003414821 6:5898387-5898409 AAGGGAGGGAGGGCAGGAGGAGG - Intergenic
1003514004 6:6803639-6803661 CCCTGAGGCAGGGCAGGAGTCGG - Intergenic
1003575794 6:7293342-7293364 ACTCGGGGAAGGGTAGGAGGGGG - Intronic
1003632761 6:7802865-7802887 ATATGCGGTAGGGAAGGAGGGGG + Intronic
1004410095 6:15373243-15373265 ACTTGAGACAGAGCAAGAGGTGG - Intronic
1004761786 6:18675180-18675202 AGCTGGGGTAGGGCAGGAGGAGG - Intergenic
1004969479 6:20893023-20893045 ACCTGAGGTAAGGCAGGTGCAGG - Intronic
1005454608 6:26007137-26007159 ACTTGAGGAAGAGGAGGAGAAGG - Intergenic
1006092579 6:31636796-31636818 AGGGGAGGTGGGGCAGGAGGTGG - Exonic
1007088522 6:39167472-39167494 ACATGGGGAAGGGCAGGAAGAGG + Intergenic
1007231993 6:40354746-40354768 ACTAGAGGTAGGGGTGGAGAAGG - Intergenic
1008194241 6:48498598-48498620 AGGTGAGGTGGGGCAAGAGGAGG - Intergenic
1009898227 6:69779455-69779477 GTTTGAGGGAGGGAAGGAGGAGG + Intronic
1010508151 6:76685979-76686001 AATGAAGGTAGGTCAGGAGGAGG - Intergenic
1010524314 6:76881469-76881491 TCTTGGGGTAAGGTAGGAGGGGG + Intergenic
1011716106 6:90106923-90106945 ACTTGAGGAAAGAGAGGAGGCGG - Intronic
1013015059 6:106153539-106153561 ATGTGAGGTAGGGAAGGAGAAGG - Intergenic
1013821144 6:114154690-114154712 GCTTGGGGGAAGGCAGGAGGAGG + Intronic
1015932796 6:138378612-138378634 ACTTCAGGTAAGACAGCAGGGGG + Intronic
1017003044 6:150008913-150008935 ACTGCAGGGAGGCCAGGAGGAGG + Intergenic
1017038122 6:150285429-150285451 TCTAGAGGTAGGGTAGGGGGTGG - Intergenic
1017483614 6:154882362-154882384 ACTTGAGGGAGGAAAGGAGGAGG + Intronic
1018013315 6:159691944-159691966 ACTTCAGGTGGGAGAGGAGGAGG - Intronic
1019089549 6:169516981-169517003 ATTTGAGGCTGGGCAGAAGGAGG + Intronic
1019520636 7:1459182-1459204 ACATGAGGTCGGGCCGGTGGCGG + Exonic
1019854117 7:3586996-3587018 ACTTGAGGTGGAGGAGGAGGAGG + Intronic
1019897439 7:3993683-3993705 CCTGGAGGAAGGGCTGGAGGAGG - Intronic
1022098464 7:27155358-27155380 AACTGAGCTAGGGGAGGAGGGGG + Intronic
1022186321 7:27973101-27973123 ACTTGGGGTGGGGCAGGGTGGGG + Intronic
1022658089 7:32339758-32339780 AGATGAGGCAGAGCAGGAGGAGG + Intergenic
1023560299 7:41467102-41467124 ACTTGAGGGCTGGCAGGAGCAGG - Intergenic
1025995683 7:66525939-66525961 ACTTGAGGCTGGCCAGGAGTTGG - Intergenic
1027159482 7:75791869-75791891 ACTTGAGCTTGGGGAGGTGGAGG - Intergenic
1027368325 7:77481639-77481661 TCTTGATCTAGGGCAGAAGGTGG - Intergenic
1027555136 7:79654548-79654570 ACTCCTGGTGGGGCAGGAGGAGG - Intergenic
1027735698 7:81930484-81930506 ACATGGTGGAGGGCAGGAGGAGG - Intergenic
1028021082 7:85773914-85773936 CCTTAAGCTATGGCAGGAGGGGG - Intergenic
1028585665 7:92448482-92448504 GCTTGTAATAGGGCAGGAGGCGG - Intronic
1029107224 7:98188156-98188178 ACTTGAGGCAGGGAAGGGGAGGG - Intronic
1029183024 7:98718282-98718304 AATCCAGGTTGGGCAGGAGGAGG + Intergenic
1029852165 7:103473987-103474009 ACTTGAGTTAGGGTAGGAGAGGG + Intronic
1031039029 7:116819355-116819377 ACTTGAGGAAGGGCTGTTGGTGG - Intronic
1032136849 7:129287260-129287282 ACTTGAGGTATCCCTGGAGGGGG - Intronic
1032624731 7:133579635-133579657 ACTTGAGGAAGGGGAGAATGGGG - Intronic
1033036316 7:137879302-137879324 TGTTGAGGTAGGGGACGAGGAGG + Exonic
1033098823 7:138453593-138453615 AGTGGAGGTAGGGCAAGAGAGGG - Intergenic
1034333474 7:150304608-150304630 ACTTGAGGGAGGGAGGGAGGAGG - Intronic
1034664569 7:152805282-152805304 ACTTGAGGGAGGGAGGGAGGAGG + Intronic
1035017396 7:155778649-155778671 AGTTCAGGTAGGGCAGGTGAGGG + Exonic
1035513145 8:207254-207276 ACTTTAAGTGGTGCAGGAGGCGG - Intergenic
1035675226 8:1451386-1451408 ACCTCAGGTCTGGCAGGAGGTGG - Intergenic
1037092097 8:14933048-14933070 ACAGCAGGGAGGGCAGGAGGGGG + Intronic
1037717572 8:21412880-21412902 ACTTGAGAAAGGGAAGGGGGAGG - Intergenic
1039333011 8:36559805-36559827 CATTGAGGTAAAGCAGGAGGTGG - Intergenic
1039461511 8:37749491-37749513 AGATGAGGGAGGGCAGGATGAGG - Intronic
1039609189 8:38905532-38905554 TCTTGATTTAGGGAAGGAGGAGG - Intronic
1040992232 8:53364964-53364986 ACTTTAGGAAGGGAAGGAAGTGG - Intergenic
1041022311 8:53650161-53650183 TCCTGGGGTAGAGCAGGAGGTGG - Intergenic
1042564784 8:70100774-70100796 AGTGAAGGTGGGGCAGGAGGGGG - Intergenic
1042734990 8:71978160-71978182 CTTTGAGGTTGGGCAGGAGGAGG - Intronic
1042810112 8:72815793-72815815 CCTTGAGGAAGGTCAGGAGAGGG + Intronic
1044749099 8:95399379-95399401 ACTTGAGGAAGGTAGGGAGGAGG + Intergenic
1045416406 8:101972069-101972091 ACTAGAGGTATGTGAGGAGGAGG + Intronic
1045648082 8:104318570-104318592 ACTTGCTGGAGGGCAGGAGAAGG + Intergenic
1047363404 8:124190384-124190406 ACGTGAGATAGGGCAGAAAGGGG + Intergenic
1047710123 8:127543415-127543437 ACTGGAGGTGGGGCAGGGGCAGG - Intergenic
1048311116 8:133323237-133323259 TCCTGGGGCAGGGCAGGAGGAGG + Intergenic
1048642568 8:136380625-136380647 TCAGGAGGGAGGGCAGGAGGGGG + Intergenic
1049462371 8:142736072-142736094 ACTGGAGGTAGAGGAGGAGGAGG - Exonic
1049618624 8:143587939-143587961 ACTGGCGGCAGGGCAGGAGGGGG - Intronic
1049694439 8:143976567-143976589 TCTCGAGCGAGGGCAGGAGGGGG + Intronic
1049884751 9:19445-19467 TCATGAGGAAGGGCAGGAGGAGG + Intergenic
1050139796 9:2505597-2505619 AGTAGAGGGAGGGCAGGAGGTGG + Intergenic
1051403711 9:16711093-16711115 ACTGGGGGGAGGGGAGGAGGAGG - Intronic
1052685953 9:31756471-31756493 ACTGGAGGTAGAGAAGGAGAAGG + Intergenic
1056221521 9:84454608-84454630 ACCAGGGGTAGGGCAGGAGTGGG - Intergenic
1057409890 9:94808757-94808779 ACTTGGGGTAGGCAAGGAGGAGG + Intronic
1058129074 9:101228928-101228950 ACTTGAGGGTGGGTGGGAGGGGG - Intronic
1058757880 9:108100579-108100601 TCTTGAGGTAGGGAAGGAAGTGG - Intergenic
1058819949 9:108720702-108720724 ACTTGGAGTAGGGCATGGGGGGG + Intergenic
1058961128 9:109993895-109993917 ACTTGAGGGAGAGGAGGAAGAGG - Intronic
1059081829 9:111258078-111258100 ATTTCAGTTAAGGCAGGAGGTGG + Intergenic
1059434035 9:114265860-114265882 ACCTCAGAAAGGGCAGGAGGAGG + Intronic
1059538797 9:115110490-115110512 AATGGAGGTGGGGCAGGGGGTGG + Intronic
1059762760 9:117354689-117354711 GCTGGAGGGAGGGAAGGAGGAGG - Intronic
1060189173 9:121581367-121581389 ACTTGTGGGGGAGCAGGAGGAGG + Intronic
1060201317 9:121653080-121653102 ACTTCAGGAAAGGCAGGAGTGGG - Intronic
1060508208 9:124214328-124214350 AGATGAGCTGGGGCAGGAGGAGG - Intergenic
1061498408 9:130989005-130989027 ACCACAGGAAGGGCAGGAGGTGG - Intergenic
1062040682 9:134402989-134403011 AACTGAGGCAGGGCAGCAGGGGG - Intronic
1186071475 X:5825983-5826005 CATTGAGGTAGGCGAGGAGGAGG + Intergenic
1187405085 X:18996681-18996703 ACCTGGGGCAGGTCAGGAGGAGG - Intronic
1188556693 X:31419780-31419802 TCTTGAGGTAGAGCTGGAGTAGG + Intronic
1188653302 X:32658729-32658751 AATGGAGGTAGGGCAGGGGGAGG - Intronic
1188941825 X:36247272-36247294 AGATGAGGAAGGGAAGGAGGGGG + Intronic
1189481123 X:41393114-41393136 GCTTGAGGTAGGATATGAGGTGG + Intergenic
1189585876 X:42461227-42461249 ACTTGGGGTAGGGCATGGGGTGG - Intergenic
1190626656 X:52343813-52343835 AGTTGAGGCAGGGTAGGAGCAGG + Intergenic
1190701355 X:52992016-52992038 AGTTGAGGCAGGGTAGGAGCAGG - Intronic
1190722654 X:53162992-53163014 AATTGGGATAGGGCAGGAGAAGG - Intergenic
1190981199 X:55457943-55457965 ACTTTGGGTGGGGCAGGTGGTGG + Intergenic
1190987499 X:55515237-55515259 ACTTTGGGTGGGGCAGGTGGTGG - Intergenic
1192166834 X:68831839-68831861 GCTTGAGGTAGATGAGGAGGGGG - Intronic
1192218466 X:69180214-69180236 GCGTGAGGGAGGGCACGAGGGGG - Intergenic
1192792528 X:74397138-74397160 ACTTGATGTCAGGCAGGTGGAGG + Intergenic
1192875138 X:75222210-75222232 CCTAGAGCTAGGGGAGGAGGAGG + Intergenic
1193849314 X:86516707-86516729 ACTTGAGAAGGGGCAGGAAGAGG - Intronic
1195362029 X:104092062-104092084 GCTTGTGGTGGGGCAGGGGGAGG - Intergenic
1196346354 X:114664367-114664389 TCTGGAGGTGGGGAAGGAGGAGG - Intronic
1196789915 X:119455148-119455170 ACTTGTGGAAGGGCAGGGTGTGG - Intergenic
1197492443 X:127134983-127135005 TCATGAGGAAGGGCGGGAGGGGG + Intergenic
1198011498 X:132560589-132560611 GCCTGAGGCAGAGCAGGAGGAGG + Intergenic
1198312242 X:135434624-135434646 ATTGGAGGAAGAGCAGGAGGAGG + Intergenic
1198434892 X:136607549-136607571 ACTCAAAGTAGGGCAGGGGGTGG + Intergenic
1199310692 X:146316473-146316495 ACTTGAGGGAGGTTAGGAGGAGG + Intergenic
1200401057 X:156020707-156020729 TCATGAGGAAGGGCAGGAGGAGG - Intergenic
1200677160 Y:6163405-6163427 ATTTGAGGTATGGCTGGAGCTGG - Intergenic