ID: 1132342555

View in Genome Browser
Species Human (GRCh38)
Location 15:101087583-101087605
Sequence CTGTGGGTCACCCAGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132342555_1132342559 -5 Left 1132342555 15:101087583-101087605 CCTCCTGGCTGGGTGACCCACAG No data
Right 1132342559 15:101087601-101087623 CACAGCCACCTCCTCTCTCCTGG No data
1132342555_1132342560 -4 Left 1132342555 15:101087583-101087605 CCTCCTGGCTGGGTGACCCACAG No data
Right 1132342560 15:101087602-101087624 ACAGCCACCTCCTCTCTCCTGGG No data
1132342555_1132342567 28 Left 1132342555 15:101087583-101087605 CCTCCTGGCTGGGTGACCCACAG No data
Right 1132342567 15:101087634-101087656 TCCTCCATGCCCTGCCTCCTTGG No data
1132342555_1132342563 4 Left 1132342555 15:101087583-101087605 CCTCCTGGCTGGGTGACCCACAG No data
Right 1132342563 15:101087610-101087632 CTCCTCTCTCCTGGGACCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132342555 Original CRISPR CTGTGGGTCACCCAGCCAGG AGG (reversed) Intergenic
No off target data available for this crispr