ID: 1132344704

View in Genome Browser
Species Human (GRCh38)
Location 15:101101217-101101239
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132344704_1132344711 -6 Left 1132344704 15:101101217-101101239 CCAAGCTCATTCATTCCCAGCCG No data
Right 1132344711 15:101101234-101101256 CAGCCGGTTTCAAGACCCGGGGG No data
1132344704_1132344713 1 Left 1132344704 15:101101217-101101239 CCAAGCTCATTCATTCCCAGCCG No data
Right 1132344713 15:101101241-101101263 TTTCAAGACCCGGGGGAAGCAGG No data
1132344704_1132344722 29 Left 1132344704 15:101101217-101101239 CCAAGCTCATTCATTCCCAGCCG No data
Right 1132344722 15:101101269-101101291 GCTGAGGGATACAGGTGGAAAGG No data
1132344704_1132344719 24 Left 1132344704 15:101101217-101101239 CCAAGCTCATTCATTCCCAGCCG No data
Right 1132344719 15:101101264-101101286 ATCCCGCTGAGGGATACAGGTGG No data
1132344704_1132344716 13 Left 1132344704 15:101101217-101101239 CCAAGCTCATTCATTCCCAGCCG No data
Right 1132344716 15:101101253-101101275 GGGGAAGCAGGATCCCGCTGAGG No data
1132344704_1132344717 14 Left 1132344704 15:101101217-101101239 CCAAGCTCATTCATTCCCAGCCG No data
Right 1132344717 15:101101254-101101276 GGGAAGCAGGATCCCGCTGAGGG No data
1132344704_1132344710 -7 Left 1132344704 15:101101217-101101239 CCAAGCTCATTCATTCCCAGCCG No data
Right 1132344710 15:101101233-101101255 CCAGCCGGTTTCAAGACCCGGGG No data
1132344704_1132344706 -9 Left 1132344704 15:101101217-101101239 CCAAGCTCATTCATTCCCAGCCG No data
Right 1132344706 15:101101231-101101253 TCCCAGCCGGTTTCAAGACCCGG No data
1132344704_1132344708 -8 Left 1132344704 15:101101217-101101239 CCAAGCTCATTCATTCCCAGCCG No data
Right 1132344708 15:101101232-101101254 CCCAGCCGGTTTCAAGACCCGGG No data
1132344704_1132344718 21 Left 1132344704 15:101101217-101101239 CCAAGCTCATTCATTCCCAGCCG No data
Right 1132344718 15:101101261-101101283 AGGATCCCGCTGAGGGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132344704 Original CRISPR CGGCTGGGAATGAATGAGCT TGG (reversed) Intergenic
No off target data available for this crispr