ID: 1132344707

View in Genome Browser
Species Human (GRCh38)
Location 15:101101232-101101254
Sequence CCCGGGTCTTGAAACCGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132344707_1132344719 9 Left 1132344707 15:101101232-101101254 CCCAGCCGGTTTCAAGACCCGGG No data
Right 1132344719 15:101101264-101101286 ATCCCGCTGAGGGATACAGGTGG No data
1132344707_1132344722 14 Left 1132344707 15:101101232-101101254 CCCAGCCGGTTTCAAGACCCGGG No data
Right 1132344722 15:101101269-101101291 GCTGAGGGATACAGGTGGAAAGG No data
1132344707_1132344718 6 Left 1132344707 15:101101232-101101254 CCCAGCCGGTTTCAAGACCCGGG No data
Right 1132344718 15:101101261-101101283 AGGATCCCGCTGAGGGATACAGG No data
1132344707_1132344716 -2 Left 1132344707 15:101101232-101101254 CCCAGCCGGTTTCAAGACCCGGG No data
Right 1132344716 15:101101253-101101275 GGGGAAGCAGGATCCCGCTGAGG No data
1132344707_1132344717 -1 Left 1132344707 15:101101232-101101254 CCCAGCCGGTTTCAAGACCCGGG No data
Right 1132344717 15:101101254-101101276 GGGAAGCAGGATCCCGCTGAGGG No data
1132344707_1132344723 18 Left 1132344707 15:101101232-101101254 CCCAGCCGGTTTCAAGACCCGGG No data
Right 1132344723 15:101101273-101101295 AGGGATACAGGTGGAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132344707 Original CRISPR CCCGGGTCTTGAAACCGGCT GGG (reversed) Intergenic
No off target data available for this crispr