ID: 1132344709

View in Genome Browser
Species Human (GRCh38)
Location 15:101101233-101101255
Sequence CCCCGGGTCTTGAAACCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132344709_1132344717 -2 Left 1132344709 15:101101233-101101255 CCAGCCGGTTTCAAGACCCGGGG No data
Right 1132344717 15:101101254-101101276 GGGAAGCAGGATCCCGCTGAGGG No data
1132344709_1132344719 8 Left 1132344709 15:101101233-101101255 CCAGCCGGTTTCAAGACCCGGGG No data
Right 1132344719 15:101101264-101101286 ATCCCGCTGAGGGATACAGGTGG No data
1132344709_1132344716 -3 Left 1132344709 15:101101233-101101255 CCAGCCGGTTTCAAGACCCGGGG No data
Right 1132344716 15:101101253-101101275 GGGGAAGCAGGATCCCGCTGAGG No data
1132344709_1132344718 5 Left 1132344709 15:101101233-101101255 CCAGCCGGTTTCAAGACCCGGGG No data
Right 1132344718 15:101101261-101101283 AGGATCCCGCTGAGGGATACAGG No data
1132344709_1132344723 17 Left 1132344709 15:101101233-101101255 CCAGCCGGTTTCAAGACCCGGGG No data
Right 1132344723 15:101101273-101101295 AGGGATACAGGTGGAAAGGAAGG No data
1132344709_1132344724 30 Left 1132344709 15:101101233-101101255 CCAGCCGGTTTCAAGACCCGGGG No data
Right 1132344724 15:101101286-101101308 GAAAGGAAGGATGAGAGTCCTGG No data
1132344709_1132344722 13 Left 1132344709 15:101101233-101101255 CCAGCCGGTTTCAAGACCCGGGG No data
Right 1132344722 15:101101269-101101291 GCTGAGGGATACAGGTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132344709 Original CRISPR CCCCGGGTCTTGAAACCGGC TGG (reversed) Intergenic
No off target data available for this crispr