ID: 1132344714

View in Genome Browser
Species Human (GRCh38)
Location 15:101101249-101101271
Sequence AGCGGGATCCTGCTTCCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132344714_1132344726 16 Left 1132344714 15:101101249-101101271 CCCGGGGGAAGCAGGATCCCGCT No data
Right 1132344726 15:101101288-101101310 AAGGAAGGATGAGAGTCCTGGGG No data
1132344714_1132344719 -8 Left 1132344714 15:101101249-101101271 CCCGGGGGAAGCAGGATCCCGCT No data
Right 1132344719 15:101101264-101101286 ATCCCGCTGAGGGATACAGGTGG No data
1132344714_1132344722 -3 Left 1132344714 15:101101249-101101271 CCCGGGGGAAGCAGGATCCCGCT No data
Right 1132344722 15:101101269-101101291 GCTGAGGGATACAGGTGGAAAGG No data
1132344714_1132344723 1 Left 1132344714 15:101101249-101101271 CCCGGGGGAAGCAGGATCCCGCT No data
Right 1132344723 15:101101273-101101295 AGGGATACAGGTGGAAAGGAAGG No data
1132344714_1132344724 14 Left 1132344714 15:101101249-101101271 CCCGGGGGAAGCAGGATCCCGCT No data
Right 1132344724 15:101101286-101101308 GAAAGGAAGGATGAGAGTCCTGG No data
1132344714_1132344725 15 Left 1132344714 15:101101249-101101271 CCCGGGGGAAGCAGGATCCCGCT No data
Right 1132344725 15:101101287-101101309 AAAGGAAGGATGAGAGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132344714 Original CRISPR AGCGGGATCCTGCTTCCCCC GGG (reversed) Intergenic
No off target data available for this crispr