ID: 1132344719

View in Genome Browser
Species Human (GRCh38)
Location 15:101101264-101101286
Sequence ATCCCGCTGAGGGATACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132344707_1132344719 9 Left 1132344707 15:101101232-101101254 CCCAGCCGGTTTCAAGACCCGGG No data
Right 1132344719 15:101101264-101101286 ATCCCGCTGAGGGATACAGGTGG No data
1132344714_1132344719 -8 Left 1132344714 15:101101249-101101271 CCCGGGGGAAGCAGGATCCCGCT No data
Right 1132344719 15:101101264-101101286 ATCCCGCTGAGGGATACAGGTGG No data
1132344704_1132344719 24 Left 1132344704 15:101101217-101101239 CCAAGCTCATTCATTCCCAGCCG No data
Right 1132344719 15:101101264-101101286 ATCCCGCTGAGGGATACAGGTGG No data
1132344712_1132344719 4 Left 1132344712 15:101101237-101101259 CCGGTTTCAAGACCCGGGGGAAG No data
Right 1132344719 15:101101264-101101286 ATCCCGCTGAGGGATACAGGTGG No data
1132344715_1132344719 -9 Left 1132344715 15:101101250-101101272 CCGGGGGAAGCAGGATCCCGCTG No data
Right 1132344719 15:101101264-101101286 ATCCCGCTGAGGGATACAGGTGG No data
1132344703_1132344719 29 Left 1132344703 15:101101212-101101234 CCGGGCCAAGCTCATTCATTCCC No data
Right 1132344719 15:101101264-101101286 ATCCCGCTGAGGGATACAGGTGG No data
1132344709_1132344719 8 Left 1132344709 15:101101233-101101255 CCAGCCGGTTTCAAGACCCGGGG No data
Right 1132344719 15:101101264-101101286 ATCCCGCTGAGGGATACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132344719 Original CRISPR ATCCCGCTGAGGGATACAGG TGG Intergenic
No off target data available for this crispr