ID: 1132344721

View in Genome Browser
Species Human (GRCh38)
Location 15:101101267-101101289
Sequence TTTCCACCTGTATCCCTCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132344721_1132344725 -3 Left 1132344721 15:101101267-101101289 CCGCTGAGGGATACAGGTGGAAA No data
Right 1132344725 15:101101287-101101309 AAAGGAAGGATGAGAGTCCTGGG No data
1132344721_1132344724 -4 Left 1132344721 15:101101267-101101289 CCGCTGAGGGATACAGGTGGAAA No data
Right 1132344724 15:101101286-101101308 GAAAGGAAGGATGAGAGTCCTGG No data
1132344721_1132344726 -2 Left 1132344721 15:101101267-101101289 CCGCTGAGGGATACAGGTGGAAA No data
Right 1132344726 15:101101288-101101310 AAGGAAGGATGAGAGTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132344721 Original CRISPR TTTCCACCTGTATCCCTCAG CGG (reversed) Intergenic
No off target data available for this crispr