ID: 1132344722

View in Genome Browser
Species Human (GRCh38)
Location 15:101101269-101101291
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132344712_1132344722 9 Left 1132344712 15:101101237-101101259 CCGGTTTCAAGACCCGGGGGAAG No data
Right 1132344722 15:101101269-101101291 GCTGAGGGATACAGGTGGAAAGG No data
1132344709_1132344722 13 Left 1132344709 15:101101233-101101255 CCAGCCGGTTTCAAGACCCGGGG No data
Right 1132344722 15:101101269-101101291 GCTGAGGGATACAGGTGGAAAGG No data
1132344707_1132344722 14 Left 1132344707 15:101101232-101101254 CCCAGCCGGTTTCAAGACCCGGG No data
Right 1132344722 15:101101269-101101291 GCTGAGGGATACAGGTGGAAAGG No data
1132344715_1132344722 -4 Left 1132344715 15:101101250-101101272 CCGGGGGAAGCAGGATCCCGCTG No data
Right 1132344722 15:101101269-101101291 GCTGAGGGATACAGGTGGAAAGG No data
1132344704_1132344722 29 Left 1132344704 15:101101217-101101239 CCAAGCTCATTCATTCCCAGCCG No data
Right 1132344722 15:101101269-101101291 GCTGAGGGATACAGGTGGAAAGG No data
1132344714_1132344722 -3 Left 1132344714 15:101101249-101101271 CCCGGGGGAAGCAGGATCCCGCT No data
Right 1132344722 15:101101269-101101291 GCTGAGGGATACAGGTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132344722 Original CRISPR GCTGAGGGATACAGGTGGAA AGG Intergenic