ID: 1132344723

View in Genome Browser
Species Human (GRCh38)
Location 15:101101273-101101295
Sequence AGGGATACAGGTGGAAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132344709_1132344723 17 Left 1132344709 15:101101233-101101255 CCAGCCGGTTTCAAGACCCGGGG No data
Right 1132344723 15:101101273-101101295 AGGGATACAGGTGGAAAGGAAGG No data
1132344714_1132344723 1 Left 1132344714 15:101101249-101101271 CCCGGGGGAAGCAGGATCCCGCT No data
Right 1132344723 15:101101273-101101295 AGGGATACAGGTGGAAAGGAAGG No data
1132344712_1132344723 13 Left 1132344712 15:101101237-101101259 CCGGTTTCAAGACCCGGGGGAAG No data
Right 1132344723 15:101101273-101101295 AGGGATACAGGTGGAAAGGAAGG No data
1132344707_1132344723 18 Left 1132344707 15:101101232-101101254 CCCAGCCGGTTTCAAGACCCGGG No data
Right 1132344723 15:101101273-101101295 AGGGATACAGGTGGAAAGGAAGG No data
1132344715_1132344723 0 Left 1132344715 15:101101250-101101272 CCGGGGGAAGCAGGATCCCGCTG No data
Right 1132344723 15:101101273-101101295 AGGGATACAGGTGGAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132344723 Original CRISPR AGGGATACAGGTGGAAAGGA AGG Intergenic
No off target data available for this crispr