ID: 1132344726

View in Genome Browser
Species Human (GRCh38)
Location 15:101101288-101101310
Sequence AAGGAAGGATGAGAGTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132344721_1132344726 -2 Left 1132344721 15:101101267-101101289 CCGCTGAGGGATACAGGTGGAAA No data
Right 1132344726 15:101101288-101101310 AAGGAAGGATGAGAGTCCTGGGG No data
1132344715_1132344726 15 Left 1132344715 15:101101250-101101272 CCGGGGGAAGCAGGATCCCGCTG No data
Right 1132344726 15:101101288-101101310 AAGGAAGGATGAGAGTCCTGGGG No data
1132344720_1132344726 -1 Left 1132344720 15:101101266-101101288 CCCGCTGAGGGATACAGGTGGAA No data
Right 1132344726 15:101101288-101101310 AAGGAAGGATGAGAGTCCTGGGG No data
1132344714_1132344726 16 Left 1132344714 15:101101249-101101271 CCCGGGGGAAGCAGGATCCCGCT No data
Right 1132344726 15:101101288-101101310 AAGGAAGGATGAGAGTCCTGGGG No data
1132344712_1132344726 28 Left 1132344712 15:101101237-101101259 CCGGTTTCAAGACCCGGGGGAAG No data
Right 1132344726 15:101101288-101101310 AAGGAAGGATGAGAGTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132344726 Original CRISPR AAGGAAGGATGAGAGTCCTG GGG Intergenic
No off target data available for this crispr