ID: 1132344877

View in Genome Browser
Species Human (GRCh38)
Location 15:101102156-101102178
Sequence GGCCCGAGGACCCAGCTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132344866_1132344877 24 Left 1132344866 15:101102109-101102131 CCAAAAGTTGAGTGCTGTGGGCC No data
Right 1132344877 15:101102156-101102178 GGCCCGAGGACCCAGCTAGAGGG No data
1132344868_1132344877 3 Left 1132344868 15:101102130-101102152 CCACACAGCCTGGACAGCTGTAG No data
Right 1132344877 15:101102156-101102178 GGCCCGAGGACCCAGCTAGAGGG No data
1132344874_1132344877 -5 Left 1132344874 15:101102138-101102160 CCTGGACAGCTGTAGGGGGGCCC No data
Right 1132344877 15:101102156-101102178 GGCCCGAGGACCCAGCTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132344877 Original CRISPR GGCCCGAGGACCCAGCTAGA GGG Intergenic
No off target data available for this crispr