ID: 1132346845

View in Genome Browser
Species Human (GRCh38)
Location 15:101113780-101113802
Sequence CCCAGGGAGTTGAGACCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132346845_1132346853 16 Left 1132346845 15:101113780-101113802 CCCTGAGGTCTCAACTCCCTGGG No data
Right 1132346853 15:101113819-101113841 AATTCAACGGCCGGCAGCAAGGG No data
1132346845_1132346850 3 Left 1132346845 15:101113780-101113802 CCCTGAGGTCTCAACTCCCTGGG No data
Right 1132346850 15:101113806-101113828 ATGTTTATCAGTGAATTCAACGG No data
1132346845_1132346852 15 Left 1132346845 15:101113780-101113802 CCCTGAGGTCTCAACTCCCTGGG No data
Right 1132346852 15:101113818-101113840 GAATTCAACGGCCGGCAGCAAGG No data
1132346845_1132346851 7 Left 1132346845 15:101113780-101113802 CCCTGAGGTCTCAACTCCCTGGG No data
Right 1132346851 15:101113810-101113832 TTATCAGTGAATTCAACGGCCGG No data
1132346845_1132346855 27 Left 1132346845 15:101113780-101113802 CCCTGAGGTCTCAACTCCCTGGG No data
Right 1132346855 15:101113830-101113852 CGGCAGCAAGGGCGACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132346845 Original CRISPR CCCAGGGAGTTGAGACCTCA GGG (reversed) Intergenic
No off target data available for this crispr