ID: 1132350558

View in Genome Browser
Species Human (GRCh38)
Location 15:101137213-101137235
Sequence CAGGCAACACGGTGGGACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132350548_1132350558 24 Left 1132350548 15:101137166-101137188 CCAAGAACATGACATCACAGGTT No data
Right 1132350558 15:101137213-101137235 CAGGCAACACGGTGGGACTGAGG No data
1132350546_1132350558 30 Left 1132350546 15:101137160-101137182 CCAAAACCAAGAACATGACATCA No data
Right 1132350558 15:101137213-101137235 CAGGCAACACGGTGGGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132350558 Original CRISPR CAGGCAACACGGTGGGACTG AGG Intergenic
No off target data available for this crispr