ID: 1132351325

View in Genome Browser
Species Human (GRCh38)
Location 15:101141471-101141493
Sequence GCCCTGCTGCTGCTGGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132351318_1132351325 11 Left 1132351318 15:101141437-101141459 CCCAGCCAGTGCGCCTGCTTCTT No data
Right 1132351325 15:101141471-101141493 GCCCTGCTGCTGCTGGTGACTGG No data
1132351319_1132351325 10 Left 1132351319 15:101141438-101141460 CCAGCCAGTGCGCCTGCTTCTTT No data
Right 1132351325 15:101141471-101141493 GCCCTGCTGCTGCTGGTGACTGG No data
1132351320_1132351325 6 Left 1132351320 15:101141442-101141464 CCAGTGCGCCTGCTTCTTTCTTA No data
Right 1132351325 15:101141471-101141493 GCCCTGCTGCTGCTGGTGACTGG No data
1132351317_1132351325 12 Left 1132351317 15:101141436-101141458 CCCCAGCCAGTGCGCCTGCTTCT No data
Right 1132351325 15:101141471-101141493 GCCCTGCTGCTGCTGGTGACTGG No data
1132351322_1132351325 -2 Left 1132351322 15:101141450-101141472 CCTGCTTCTTTCTTACCACAGGC No data
Right 1132351325 15:101141471-101141493 GCCCTGCTGCTGCTGGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132351325 Original CRISPR GCCCTGCTGCTGCTGGTGAC TGG Intergenic
No off target data available for this crispr