ID: 1132351690

View in Genome Browser
Species Human (GRCh38)
Location 15:101143265-101143287
Sequence AGCTATAAACTAGAGATGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132351689_1132351690 -4 Left 1132351689 15:101143246-101143268 CCTCTCTCACAGGCTCTGAAGCT No data
Right 1132351690 15:101143265-101143287 AGCTATAAACTAGAGATGTGAGG No data
1132351687_1132351690 2 Left 1132351687 15:101143240-101143262 CCCATTCCTCTCTCACAGGCTCT No data
Right 1132351690 15:101143265-101143287 AGCTATAAACTAGAGATGTGAGG No data
1132351688_1132351690 1 Left 1132351688 15:101143241-101143263 CCATTCCTCTCTCACAGGCTCTG No data
Right 1132351690 15:101143265-101143287 AGCTATAAACTAGAGATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132351690 Original CRISPR AGCTATAAACTAGAGATGTG AGG Intergenic
No off target data available for this crispr