ID: 1132353379

View in Genome Browser
Species Human (GRCh38)
Location 15:101154454-101154476
Sequence GGGTTGGTGAGGAGTGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132353372_1132353379 23 Left 1132353372 15:101154408-101154430 CCGCTAATTTGAGCTGCTTGCAA No data
Right 1132353379 15:101154454-101154476 GGGTTGGTGAGGAGTGCAGATGG No data
1132353371_1132353379 24 Left 1132353371 15:101154407-101154429 CCCGCTAATTTGAGCTGCTTGCA No data
Right 1132353379 15:101154454-101154476 GGGTTGGTGAGGAGTGCAGATGG No data
1132353370_1132353379 25 Left 1132353370 15:101154406-101154428 CCCCGCTAATTTGAGCTGCTTGC No data
Right 1132353379 15:101154454-101154476 GGGTTGGTGAGGAGTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132353379 Original CRISPR GGGTTGGTGAGGAGTGCAGA TGG Intergenic
No off target data available for this crispr