ID: 1132353411

View in Genome Browser
Species Human (GRCh38)
Location 15:101154563-101154585
Sequence CCCACCCAGCCCAACCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132353411_1132353414 3 Left 1132353411 15:101154563-101154585 CCATCAGGGTTGGGCTGGGTGGG No data
Right 1132353414 15:101154589-101154611 GAACCTGCCAGGTCTTCCTCCGG No data
1132353411_1132353416 7 Left 1132353411 15:101154563-101154585 CCATCAGGGTTGGGCTGGGTGGG No data
Right 1132353416 15:101154593-101154615 CTGCCAGGTCTTCCTCCGGCAGG No data
1132353411_1132353413 -8 Left 1132353411 15:101154563-101154585 CCATCAGGGTTGGGCTGGGTGGG No data
Right 1132353413 15:101154578-101154600 TGGGTGGGAGAGAACCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132353411 Original CRISPR CCCACCCAGCCCAACCCTGA TGG (reversed) Intergenic
No off target data available for this crispr