ID: 1132356414

View in Genome Browser
Species Human (GRCh38)
Location 15:101174402-101174424
Sequence CCACATGTGCCTCCTGCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132356414_1132356423 24 Left 1132356414 15:101174402-101174424 CCTTTGGCAGGAGGCACATGTGG No data
Right 1132356423 15:101174449-101174471 AGTGTGGTTCCCAACACGCCAGG No data
1132356414_1132356419 -7 Left 1132356414 15:101174402-101174424 CCTTTGGCAGGAGGCACATGTGG No data
Right 1132356419 15:101174418-101174440 CATGTGGAGAGGGCGCTCGAGGG No data
1132356414_1132356424 25 Left 1132356414 15:101174402-101174424 CCTTTGGCAGGAGGCACATGTGG No data
Right 1132356424 15:101174450-101174472 GTGTGGTTCCCAACACGCCAGGG No data
1132356414_1132356425 26 Left 1132356414 15:101174402-101174424 CCTTTGGCAGGAGGCACATGTGG No data
Right 1132356425 15:101174451-101174473 TGTGGTTCCCAACACGCCAGGGG No data
1132356414_1132356418 -8 Left 1132356414 15:101174402-101174424 CCTTTGGCAGGAGGCACATGTGG No data
Right 1132356418 15:101174417-101174439 ACATGTGGAGAGGGCGCTCGAGG No data
1132356414_1132356426 30 Left 1132356414 15:101174402-101174424 CCTTTGGCAGGAGGCACATGTGG No data
Right 1132356426 15:101174455-101174477 GTTCCCAACACGCCAGGGGACGG No data
1132356414_1132356422 8 Left 1132356414 15:101174402-101174424 CCTTTGGCAGGAGGCACATGTGG No data
Right 1132356422 15:101174433-101174455 CTCGAGGGAGTAGGGCAGTGTGG No data
1132356414_1132356421 0 Left 1132356414 15:101174402-101174424 CCTTTGGCAGGAGGCACATGTGG No data
Right 1132356421 15:101174425-101174447 AGAGGGCGCTCGAGGGAGTAGGG No data
1132356414_1132356420 -1 Left 1132356414 15:101174402-101174424 CCTTTGGCAGGAGGCACATGTGG No data
Right 1132356420 15:101174424-101174446 GAGAGGGCGCTCGAGGGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132356414 Original CRISPR CCACATGTGCCTCCTGCCAA AGG (reversed) Intergenic
No off target data available for this crispr