ID: 1132356925

View in Genome Browser
Species Human (GRCh38)
Location 15:101178598-101178620
Sequence GCGGAGTCCATTCCTCTTCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 39}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132356916_1132356925 18 Left 1132356916 15:101178557-101178579 CCATGACCTGCATGACAATGTCG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1132356925 15:101178598-101178620 GCGGAGTCCATTCCTCTTCGAGG 0: 1
1: 1
2: 0
3: 2
4: 39
1132356922_1132356925 -6 Left 1132356922 15:101178581-101178603 CCAAGGCTTCCCTCTGGGCGGAG 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1132356925 15:101178598-101178620 GCGGAGTCCATTCCTCTTCGAGG 0: 1
1: 1
2: 0
3: 2
4: 39
1132356917_1132356925 12 Left 1132356917 15:101178563-101178585 CCTGCATGACAATGTCGTCCAAG 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1132356925 15:101178598-101178620 GCGGAGTCCATTCCTCTTCGAGG 0: 1
1: 1
2: 0
3: 2
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132356925 Original CRISPR GCGGAGTCCATTCCTCTTCG AGG Exonic