ID: 1132356984

View in Genome Browser
Species Human (GRCh38)
Location 15:101179111-101179133
Sequence CACATTGGACTGCTGTTGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132356984_1132356988 19 Left 1132356984 15:101179111-101179133 CCGATCAACAGCAGTCCAATGTG 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1132356988 15:101179153-101179175 AGAAACTGCTTAAGGAAGTAAGG 0: 1
1: 0
2: 1
3: 30
4: 480
1132356984_1132356989 20 Left 1132356984 15:101179111-101179133 CCGATCAACAGCAGTCCAATGTG 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1132356989 15:101179154-101179176 GAAACTGCTTAAGGAAGTAAGGG 0: 1
1: 0
2: 1
3: 22
4: 285
1132356984_1132356987 11 Left 1132356984 15:101179111-101179133 CCGATCAACAGCAGTCCAATGTG 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1132356987 15:101179145-101179167 TCACAGATAGAAACTGCTTAAGG 0: 1
1: 0
2: 2
3: 12
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132356984 Original CRISPR CACATTGGACTGCTGTTGAT CGG (reversed) Intronic
905399116 1:37689062-37689084 CACTTTGTTCTGCTGTAGATTGG - Intronic
907692143 1:56679766-56679788 CACATTGGTCTACTTATGATTGG + Intronic
911781539 1:101885798-101885820 CACATTAGCCTGTTGTTGACTGG - Intronic
912415963 1:109508748-109508770 CACATTGGGCAGCTGCTGCTTGG + Exonic
915524043 1:156465409-156465431 CACATTGAACTGCAGTTGGGGGG - Exonic
916788761 1:168106043-168106065 CACTTAGGACTGCTGGTGAGGGG - Intronic
918671712 1:187224919-187224941 CACACTGCACTGCTTTTGTTAGG + Intergenic
920367946 1:205457741-205457763 AATATTGGACTGCAGTTGAGGGG - Intergenic
921084301 1:211773726-211773748 CACAGTGCACTGCTGTTCAGTGG - Intronic
1063928466 10:11004488-11004510 TACATTGTACTTCTGTTTATTGG - Intergenic
1065269635 10:24014845-24014867 CACATTGAATTGCTGTTAAAGGG + Intronic
1065685273 10:28278205-28278227 TACATAGGAGTGCTGTTGCTAGG - Intronic
1067259692 10:44678595-44678617 GACATTGGGGTGCTGTTGCTTGG - Intergenic
1071054031 10:81487864-81487886 CCCATTGGAGGGCTGTTAATTGG - Intergenic
1071205037 10:83264958-83264980 CACATTGGCCTGGTTTTTATGGG + Intergenic
1073653709 10:105389475-105389497 CACTTTGGACTGCAGGTGTTTGG + Intergenic
1074402035 10:113149737-113149759 TACATTGGACTGCTTTGGTTTGG + Intronic
1077583583 11:3433808-3433830 CCCATTCAACTGTTGTTGATAGG + Intergenic
1083602269 11:63956100-63956122 CACTTTGCGCTGCTCTTGATGGG + Exonic
1084551448 11:69845532-69845554 CAGATTGTTCTGCTTTTGATGGG + Intergenic
1099921056 12:88957644-88957666 AACAATGGAATTCTGTTGATTGG - Intergenic
1101809774 12:108097640-108097662 GACATTGCACTGCAGATGATTGG + Intergenic
1103085423 12:118059362-118059384 CACATTAGACTTCTGTTGGTCGG + Intronic
1103639869 12:122341697-122341719 TTCTTTGGACTGCTGTTAATAGG - Exonic
1106279069 13:28247031-28247053 AACATTGGTATGCTGTTGATGGG - Intronic
1107593181 13:41930599-41930621 CACATTTGACTGCATGTGATAGG + Intronic
1108650409 13:52472794-52472816 CACCTTGGACTTCTGGTGTTGGG - Intronic
1109193849 13:59356698-59356720 CACGTTGCACTGGGGTTGATCGG + Intergenic
1111657102 13:91167454-91167476 CACATTAGACTTCTGATGATGGG - Intergenic
1113272821 13:108693653-108693675 CACTTTGGGCTGCTGTTGATAGG + Intronic
1114184608 14:20391065-20391087 AACTATGCACTGCTGTTGATTGG - Exonic
1115797597 14:36956460-36956482 CACATTGGCCTGATGTTATTTGG - Intronic
1117025330 14:51613778-51613800 CACATTGTATTTCTGTTGAATGG - Intronic
1120304757 14:82755058-82755080 AACATTGGTATACTGTTGATGGG + Intergenic
1120526534 14:85583453-85583475 CACATTTGAATTCTGTTCATGGG - Intronic
1121557173 14:94847164-94847186 CACACTGGACTGCTCTGGCTCGG + Intergenic
1125596120 15:40887476-40887498 CTCCTTGGACTGCTCTTGACTGG - Intergenic
1127458050 15:59172401-59172423 CACAGTGGACTGCTGTTACCAGG + Intronic
1132079661 15:98853282-98853304 CACATTGTACTGCTGGAAATGGG - Intronic
1132356984 15:101179111-101179133 CACATTGGACTGCTGTTGATCGG - Intronic
1132588522 16:716353-716375 CACACTGGACTTTTGTTGGTTGG - Intronic
1139028394 16:62848219-62848241 CAAACAGCACTGCTGTTGATTGG + Intergenic
1153369903 18:4303510-4303532 CACATGGCACTGCTGTTCTTGGG - Intronic
1156620463 18:38845641-38845663 CAAATTGGACTGTTGTTTCTTGG + Intergenic
931698103 2:64887265-64887287 CACATTGGAAGGCTATTGAGAGG + Intergenic
936956345 2:118026438-118026460 CACCTTGGACACCTGTTGTTAGG - Intergenic
938160128 2:128978454-128978476 CACAGTGGAGTGCTGTGAATGGG + Intergenic
939520118 2:143219664-143219686 CACATTGAACTGGTGTGAATTGG - Intronic
942028692 2:171936579-171936601 AGAATTGGACTGCTGTTAATGGG + Intronic
946978165 2:225176190-225176212 TATATTGGACTGCTTTTGCTTGG + Intergenic
947941154 2:234056674-234056696 AACAATGGACTTCAGTTGATGGG + Intronic
1170183184 20:13556304-13556326 CACCTTGGACTGTAGGTGATAGG - Intronic
1177569019 21:22861807-22861829 CACATTGTATTTCTGTGGATGGG - Intergenic
1179526183 21:41977429-41977451 CCCTCTGTACTGCTGTTGATGGG + Intergenic
952309242 3:32172533-32172555 CACATTGGTCTGTGATTGATAGG + Intergenic
956515774 3:70046323-70046345 CACTTTGGAGTCCTGCTGATTGG + Intergenic
959728018 3:109567321-109567343 CACAGTCTACTGCTGTTTATTGG + Intergenic
971709088 4:30088525-30088547 CACATTTTCCTGCTGTTTATGGG + Intergenic
971868622 4:32206652-32206674 TACATTGGACATCTGTTGTTTGG - Intergenic
973306064 4:48651459-48651481 CACATTGGTCTGCTGGGCATGGG - Intronic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
984052755 4:174887421-174887443 CAGATTGAAGTGCTGTTGAAAGG + Intronic
985857123 5:2437356-2437378 CACTTTGTCCTGCTGTTGAAAGG - Intergenic
986928342 5:12786684-12786706 CATTTTGGAAGGCTGTTGATAGG - Intergenic
989339431 5:40356432-40356454 AAGCTTGGACTGTTGTTGATTGG - Intergenic
990229464 5:53696106-53696128 CACATTCTACTGCTGTTGGATGG - Intergenic
991612069 5:68459785-68459807 GACACTTAACTGCTGTTGATGGG + Intergenic
992053054 5:72958560-72958582 CAGTTTGGATTGCTGTTGTTTGG + Intronic
992154364 5:73940209-73940231 CACAGTGTCCTGCTGTTGCTAGG + Intronic
994025280 5:95074320-95074342 CACTTTGAAGTGCTGTTGCTTGG + Intronic
994157823 5:96523219-96523241 CACATGGCACTGCTGCTGACTGG + Intergenic
994890800 5:105632955-105632977 CACATTGGATTAATGATGATTGG + Intergenic
996127280 5:119740883-119740905 CCCATAGGACAGCTATTGATTGG - Intergenic
1001183580 5:169544933-169544955 CCCATTGGATTGCTGTCTATGGG + Intergenic
1002192981 5:177488439-177488461 CACACTGAACTGCTGGTGACAGG + Intronic
1005113256 6:22309072-22309094 CATATTAGAATGGTGTTGATGGG - Intergenic
1007459615 6:42008654-42008676 CAGAGCTGACTGCTGTTGATTGG + Intronic
1007695720 6:43733306-43733328 CACAGTGGACAGGTGTTGAAGGG - Intergenic
1011096204 6:83666837-83666859 CACATGGGACTGCATTTGAAAGG - Intronic
1011994523 6:93568312-93568334 CACTTTGCAATGCTGTTGTTTGG + Intergenic
1012955275 6:105563270-105563292 CTCAGTGGATTCCTGTTGATTGG + Intergenic
1024504236 7:50148045-50148067 CACTTTAGACTGCTGCTGATAGG - Intronic
1026738391 7:72963357-72963379 GACATTGGAATGCTGTTCTTAGG - Intronic
1027105343 7:75401713-75401735 GACATTGGAATGCTGTTCTTAGG + Intronic
1027185502 7:75968502-75968524 CACACTGGACTGCTCTGAATGGG - Intronic
1028284903 7:88983771-88983793 CACATTATATTTCTGTTGATTGG + Intronic
1029158892 7:98537171-98537193 CACATTGGGGTGCTGATAATTGG + Intergenic
1031114187 7:117649955-117649977 CACATTGGATTCCTATTGCTTGG - Intronic
1037246687 8:16843449-16843471 CACATTGGAATTCTGCTGAGTGG - Intergenic
1037844817 8:22273852-22273874 CATATAGTCCTGCTGTTGATTGG - Intergenic
1040558724 8:48504694-48504716 CACACTGCACTGCTGTGGAAAGG + Intergenic
1040839601 8:51771255-51771277 CATATAGGACTGCTGTGGATTGG - Intronic
1047582324 8:126229745-126229767 CAGATGAGACTGTTGTTGATTGG - Intergenic
1049497489 8:142943207-142943229 CAGAGTGGACTGCAGTTCATAGG + Intergenic
1049641724 8:143718982-143719004 CACATTGGACGGCTGCAGAGAGG - Exonic
1050496776 9:6251173-6251195 CACAGTAGACTGCTGTTGACAGG - Exonic
1056454253 9:86745024-86745046 CACATTGGACTGCCCTTTAGAGG - Intergenic
1057420421 9:94907749-94907771 CACCTTGGTCAGCTGTTGAGAGG - Intronic
1057519120 9:95747061-95747083 CACATTGAACTACAGTTAATTGG + Intergenic
1189907405 X:45775674-45775696 CCCATTGGAATGCTCTTGAGAGG - Intergenic
1200393563 X:155968795-155968817 CAAATTGGACTGCAGGTAATTGG - Intergenic
1201118350 Y:10851867-10851889 CACAATTGACTGCAGTGGATTGG - Intergenic
1201128527 Y:10935182-10935204 CAAATTGGAATGGAGTTGATGGG - Intergenic