ID: 1132359402

View in Genome Browser
Species Human (GRCh38)
Location 15:101200369-101200391
Sequence GAGCCTGGCCTGCTTCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 7, 3: 30, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132359396_1132359402 29 Left 1132359396 15:101200317-101200339 CCTACTGCATTTCACATGACGGG 0: 1
1: 0
2: 1
3: 10
4: 70
Right 1132359402 15:101200369-101200391 GAGCCTGGCCTGCTTCTCACAGG 0: 1
1: 0
2: 7
3: 30
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132359402 Original CRISPR GAGCCTGGCCTGCTTCTCAC AGG Intronic
900090557 1:918525-918547 GTGCCTGGGCTGCTGCTCCCCGG + Intergenic
900488775 1:2935974-2935996 GGGCCTGCCCTGCTCCCCACAGG + Intergenic
900990167 1:6095079-6095101 GAGCCTGGGCTGCTCATAACTGG + Intronic
901862904 1:12086193-12086215 GAGCCTGGTCTGCATCTCATGGG - Intronic
902296341 1:15469787-15469809 GAGCCTGGCCTGAGACTGACTGG + Intronic
902299133 1:15489059-15489081 GAGCCTGGCCTGAGACTGACTGG + Intronic
902566441 1:17314676-17314698 GACCTTGGGCTGCTTCTGACAGG - Intronic
902988552 1:20170661-20170683 GGGGCTGGCCTGGTCCTCACGGG + Intronic
903028122 1:20443812-20443834 GAACCAAGCCTGCTTCTCAGAGG + Intergenic
903124319 1:21237434-21237456 GACCCTGCCCAGCTGCTCACAGG + Intronic
905391168 1:37636119-37636141 GAGCCTTCCCTGCGTCTAACCGG + Intergenic
905412017 1:37777122-37777144 AAGCCTGGCTTCCTTCTCATCGG - Intergenic
906204717 1:43980512-43980534 TGGCCTGGCCTGCTTGTCGCTGG + Intronic
906733643 1:48104285-48104307 GAGGCTGACCTGCTGCTCCCAGG + Intergenic
907044393 1:51290980-51291002 GAGCATGGCCTGGTCCTCAAAGG - Intronic
907274672 1:53310572-53310594 GAGCCAGCCCAGCTCCTCACAGG - Intronic
908269011 1:62404866-62404888 CACCCTGGGCTGCCTCTCACAGG + Intergenic
909767432 1:79373916-79373938 GAGCATGGCATGCTTCCCACTGG + Intergenic
913053958 1:115140518-115140540 AAGCCTGGCCTGCTCTTGACTGG - Intergenic
915171108 1:153977676-153977698 GCGCCTCGCCTGCTGCTCACTGG + Exonic
915605420 1:156947338-156947360 GAGCCGGGCCAGCTCCTCCCGGG + Exonic
916556191 1:165896241-165896263 GATCCTGGCCTTCTACTCCCAGG + Exonic
917250117 1:173049933-173049955 CAGCTTGGCCTGCATCTCAATGG + Intronic
920559945 1:206931857-206931879 CAGGCTGGGCTGCTTCTCTCTGG + Intronic
920686105 1:208110133-208110155 GACCCTGGCCTTATTCTCTCAGG + Intronic
922410163 1:225365715-225365737 GAGCATGGTCTGCTGCTCTCTGG - Intronic
922619000 1:226979328-226979350 GAGCCCGGCCTGGTGTTCACAGG - Intronic
922785701 1:228281320-228281342 GAACCTGTCCTGCTTTTCAGGGG + Intronic
922792567 1:228318229-228318251 CAGCTTGGCCTTCCTCTCACAGG + Intronic
922802707 1:228371564-228371586 GAGGGTGGCCTGCTCCTCCCTGG - Exonic
1064065421 10:12177133-12177155 AAGCCTGGCCTACTTATCATTGG + Intronic
1065775817 10:29119315-29119337 CAGCATGGCCCGCTTTTCACAGG - Intergenic
1067339217 10:45387640-45387662 GAGCCAGGCTTGGTTCTCACTGG - Intronic
1067509144 10:46881076-46881098 GAGTCAGCCTTGCTTCTCACTGG + Intergenic
1067653108 10:48170774-48170796 GAGTCAGCCTTGCTTCTCACTGG - Intronic
1068687902 10:59888352-59888374 AAGCCAGGTCTGCTTCACACAGG + Intronic
1069632582 10:69905938-69905960 GAGGCAGGCCAGGTTCTCACTGG + Intronic
1069687518 10:70327896-70327918 CAGCGTGGCCTGCTTCTCTTAGG - Intronic
1070160659 10:73865053-73865075 GACCCTGTCAAGCTTCTCACTGG - Intronic
1071328889 10:84541507-84541529 GGGCTTGGCCTCCTTCCCACAGG + Intergenic
1071603535 10:86970390-86970412 TAGCCTGGCCTGGGTCTCCCGGG - Intronic
1072776487 10:98201549-98201571 GTGCCTTGCCTCCTTCTCAAGGG + Intronic
1073939188 10:108674640-108674662 GACCCTGGACAGCATCTCACAGG - Intergenic
1074867054 10:117550809-117550831 GACCCGGGCTTGCGTCTCACAGG + Intergenic
1075635096 10:124025360-124025382 GAGCGTGGCCTGGCTCTCAAAGG - Intronic
1075861949 10:125684578-125684600 GAGCCTGGACTACTTCCCTCTGG - Intergenic
1076009418 10:126975405-126975427 AAGCAGGGCCTGCTTCTCCCAGG + Intronic
1076186882 10:128457280-128457302 GAGCCCGGTCCTCTTCTCACTGG + Intergenic
1076233261 10:128839358-128839380 AGCCCTGGCCTGCTTCTGACAGG - Intergenic
1076370406 10:129949379-129949401 GAGCCTGGGATGCTGCTCACTGG - Intronic
1076812857 10:132898336-132898358 GAGCCTGGCCAGCTTCTCGCTGG - Intronic
1077231806 11:1461139-1461161 GAGCCTGGCCTTCCTCCCACGGG - Exonic
1077265342 11:1645760-1645782 GCCACTGGCCTGCTTTTCACTGG + Intergenic
1077908964 11:6557945-6557967 CAGCATGGCCTGCTGCTCTCGGG + Exonic
1078927121 11:15885072-15885094 GAGCAGGGGCTGCTTCTTACAGG - Intergenic
1080869862 11:36227768-36227790 GATCCTGGCCTGCTCCTCCTGGG + Intronic
1083332700 11:61906338-61906360 GAGCCTGTCCTGCGCCTCTCTGG - Intronic
1084112443 11:67023014-67023036 GTGCTTGGCCTGCCTCTCAGAGG + Intronic
1085255329 11:75169431-75169453 GAGCCTGGCCTGACCCTCAGAGG - Intronic
1085303909 11:75474490-75474512 GAGCCTGGCCTCCTGCTGCCAGG + Intronic
1087509191 11:99068546-99068568 TAACCCAGCCTGCTTCTCACGGG - Intronic
1088706135 11:112466265-112466287 ACCCCTGGCCTGCTTCTCAAAGG + Intergenic
1088898512 11:114095796-114095818 GAGCCTGGTCTGCTTCCCATGGG - Intronic
1089050405 11:115540392-115540414 GAGCCTGGCTTGCTTTACCCTGG + Intergenic
1091749270 12:3012431-3012453 GAGCCTGGCCTGTAGCTCCCAGG - Intronic
1091791328 12:3273785-3273807 GAGCCAGGCCTGCCCCGCACAGG - Intronic
1091972114 12:4796384-4796406 GAGCCGGGCCTGATTCTCAGAGG - Intronic
1091995930 12:4994087-4994109 GAGCTTGGCCAGCTGATCACCGG - Intergenic
1092197684 12:6559633-6559655 GAGTCTGGCCTGGATCTCAAGGG - Intronic
1092241189 12:6837497-6837519 GACCCAGGCCTACTTCTCCCCGG + Exonic
1092970864 12:13693533-13693555 AACCCAGGGCTGCTTCTCACAGG + Intronic
1095684797 12:45021623-45021645 GGGCCTGGCCTGCCACTCAGTGG - Intronic
1095969864 12:47894263-47894285 GAGCCAGGCCTGCTGCCCACCGG + Intronic
1097011314 12:55955361-55955383 GTGCCTGGGATTCTTCTCACAGG - Exonic
1097717644 12:62983317-62983339 GTGCCTGGCTTGCTTCACCCTGG - Intergenic
1099873269 12:88374085-88374107 GAGGCTGCTCTGCTTCTCTCAGG + Intergenic
1100917010 12:99435617-99435639 TTGCCTTGCCTGCTTCTCAGGGG - Intronic
1104939137 12:132386688-132386710 GAGCCTGGCCTGCCGCACAGGGG + Intergenic
1105705164 13:22963819-22963841 GAGCCTCGCCTGCTGCTGACGGG + Intergenic
1105847706 13:24307925-24307947 GATCCTGGCCTCCTGCTTACAGG - Intronic
1105882679 13:24617744-24617766 GGGCCCTGCCTGCTCCTCACAGG + Intergenic
1108177919 13:47812849-47812871 GAAGCTGGCCTGGCTCTCACAGG + Intergenic
1110891842 13:80705629-80705651 GAGCCTGCCCCACTTCTCCCCGG + Intergenic
1111642394 13:90985030-90985052 TAGTCTGACCTACTTCTCACAGG - Intergenic
1112342766 13:98566129-98566151 TAGCCTGGCGTGCTTCTGGCTGG - Intronic
1112872900 13:103996561-103996583 AAGCCTGGACTGCTTGTCTCAGG - Intergenic
1113841857 13:113365080-113365102 GAGGCCGGGCTGCTTCTCACAGG - Intergenic
1114411894 14:22508797-22508819 GCGGCTGACATGCTTCTCACTGG - Intergenic
1120133429 14:80835045-80835067 GAGGCTGGACTGGTTCTCAAGGG + Intronic
1122359794 14:101152459-101152481 CAGCCTGGGATGCTTCTCATGGG + Intergenic
1122509022 14:102250793-102250815 GAGCCTGGCCTGGTGCTACCTGG + Exonic
1122539536 14:102490189-102490211 GATCCTGTGCTGCTTCCCACTGG + Intronic
1123935396 15:25191629-25191651 GAGCCTGGGCTGCCTCACAGAGG - Intergenic
1123938042 15:25203435-25203457 GAGCCTGGGCTGCCTCACAGAGG - Intergenic
1123939950 15:25212006-25212028 GAGCCTGGGCTGCCTCACAGAGG - Intergenic
1123942514 15:25223457-25223479 GAGCCTGGGCTGCCTCACAGAGG - Intergenic
1123943365 15:25227317-25227339 GAGCCTGGGCTGCCTCACAGAGG - Intergenic
1123943761 15:25229176-25229198 GAGCCTGGGCTGCCTCACAGAGG - Intergenic
1124206752 15:27727392-27727414 GAAGCTGGCCTCATTCTCACTGG - Intergenic
1124264234 15:28219374-28219396 GAGCCAGGCCTGCTTCCTGCAGG + Intronic
1124396063 15:29303004-29303026 CAGACTGGCCTGCTCCTCCCTGG - Intronic
1124617006 15:31249123-31249145 GAGCCTGGCCTGTGCCTCTCTGG + Intergenic
1128242021 15:66107699-66107721 GAGGGTGGCCTGCTTCAGACAGG - Intronic
1129221643 15:74134836-74134858 GAGCCTGGCGGCCTGCTCACTGG + Exonic
1129893769 15:79089412-79089434 GAGCCAGGCCTGGCTCTAACAGG - Intronic
1130199333 15:81810574-81810596 GTGCCAGGCCAGATTCTCACTGG - Intergenic
1130966276 15:88700130-88700152 AAGCATGGGCTGCCTCTCACTGG - Intergenic
1131048194 15:89329329-89329351 GAGCCAGGCCTGCATCTTAAAGG - Intronic
1131057120 15:89381756-89381778 GTGCATGTCCTGTTTCTCACTGG + Intergenic
1132120327 15:99170114-99170136 GAGCCTGGCCAGCTTCCCAGAGG - Intronic
1132359402 15:101200369-101200391 GAGCCTGGCCTGCTTCTCACAGG + Intronic
1132365494 15:101253550-101253572 GCGCCCGGCCAGCTTTTCACTGG - Intergenic
1132675333 16:1119021-1119043 GAGGCTGGGCAGCTGCTCACAGG - Intergenic
1132731216 16:1362915-1362937 GAGCCTGGCCCTCTCCCCACAGG - Intronic
1132760274 16:1505609-1505631 GCGCCTGGTCAGCTCCTCACGGG + Intronic
1133631808 16:7629148-7629170 GGCCCTGGGCTGCTTCTCCCTGG + Intronic
1134122612 16:11596001-11596023 GAGCCAGGCCGCCTGCTCACTGG - Intronic
1136046212 16:27617332-27617354 GTTCCAGGCCTGCTTCTCATTGG + Intronic
1139826590 16:69762271-69762293 GAGCCTGGCCAGCCTCTTCCGGG + Intergenic
1141661370 16:85443351-85443373 GAGCCTGGCCTGGCTCCCACTGG + Intergenic
1142306393 16:89288324-89288346 CAGCCTGGACGGCCTCTCACAGG - Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1142535815 17:617108-617130 GAGCCTGTCCTGATGCTCTCCGG + Intronic
1144417834 17:15068582-15068604 GAGCCCGGCCTACTTCTTAAAGG + Intergenic
1144812088 17:18006977-18006999 GCGCCGGGCCTGCTCCTCCCGGG + Intronic
1147741811 17:42674360-42674382 GAGACAGGCCCGCTCCTCACTGG + Exonic
1148150736 17:45395368-45395390 CAGCCGGGCCTTCTTCTCTCTGG - Exonic
1151956235 17:77381484-77381506 GGGCCTGGCCTGCCCCTCGCAGG - Intronic
1152109078 17:78347476-78347498 GAGCCTGGCCTGATGGTCCCAGG + Intergenic
1152310883 17:79549104-79549126 AAGCCTGGCCTGGTTATAACTGG - Intergenic
1152630142 17:81407234-81407256 GAGCCCAGCCTGCTGCTCAGAGG - Intronic
1152753288 17:82076496-82076518 GTGCTTGGCCTGGTGCTCACAGG + Intergenic
1152826994 17:82472826-82472848 GAGCTTGGCCTGATTCACAGAGG + Intronic
1153295891 18:3546129-3546151 AAGCCTGGCCTGTTTTTCAGTGG - Intronic
1153894554 18:9546524-9546546 AAACCTGCCCTGTTTCTCACAGG - Intergenic
1154331910 18:13437030-13437052 GAGCCCAGCCTGCCTCTCAGCGG - Intronic
1155255356 18:23992605-23992627 AAGCATGGCTTGCTTCTCCCTGG + Intergenic
1155344303 18:24843404-24843426 GAGCCTGGCCTTGAACTCACAGG - Intergenic
1156711339 18:39950179-39950201 AAACCTGGTCTCCTTCTCACTGG - Intergenic
1156894442 18:42229429-42229451 GAGCTTGGCCTGCTCCTCAGAGG + Intergenic
1157947030 18:51991898-51991920 AAGCCTGGCCTGCATCTCCAGGG - Intergenic
1160032998 18:75278655-75278677 GAGCCTGGCCTGCTGCTGCCTGG + Intronic
1160431965 18:78818994-78819016 GCTCCTGGCCTGCATCTCCCTGG - Intergenic
1160533296 18:79577720-79577742 GAGCCCAGCCTTCCTCTCACTGG + Intergenic
1162448918 19:10742613-10742635 GAGCCTGGCCTTCCTGTCTCTGG + Intronic
1166044782 19:40223504-40223526 GAGCGCGGACTCCTTCTCACGGG - Exonic
1167529050 19:50003433-50003455 GACCCTGAGCTGCTGCTCACGGG + Intronic
925025033 2:600911-600933 GCTCAGGGCCTGCTTCTCACGGG - Intergenic
925688435 2:6495772-6495794 GAGCCTGACCTGCACCTCACGGG - Intergenic
926272096 2:11374578-11374600 GGGCCTGTCCTGGCTCTCACAGG - Intergenic
927240636 2:20917115-20917137 AAGCCTGGCCAGCTTGTGACTGG + Intergenic
927733882 2:25500879-25500901 GAGCAAGGGCTGCTTCTCAGCGG + Intronic
928174418 2:29024285-29024307 GAGACTGGCCGGCTGCTCTCTGG - Exonic
929918627 2:46156347-46156369 GAGCCTGCTGTGCTTCTCTCAGG + Intronic
932220238 2:69993534-69993556 GGGCCAGCCGTGCTTCTCACAGG - Intergenic
933721724 2:85401462-85401484 GAGCCAGCCCTGCTTCTGGCTGG - Intronic
933805740 2:85997149-85997171 GAGCCTGGCCTTCTTCCTGCAGG - Intergenic
934686330 2:96324816-96324838 GGGCCTTGCTTGCTACTCACTGG - Intergenic
934709020 2:96503241-96503263 GGGCAAGGCCTGCTTCTCAAGGG - Intronic
935927811 2:108089304-108089326 GATGGTGGCCTTCTTCTCACAGG - Intergenic
936938995 2:117863568-117863590 AAGCCTTGCCTGCTTCCCTCAGG + Intergenic
938163794 2:129009172-129009194 GTCCCTGGCCTGCCTCTCCCTGG - Intergenic
939366423 2:141238502-141238524 GAGCCTGGCTAGCTTCTGCCAGG + Intronic
939671817 2:145022263-145022285 GAGACTGGCCTGCTTTTTAGAGG + Intergenic
939879667 2:147615668-147615690 GGGCCTCCCCTGCTTCTCAGTGG + Intergenic
940849047 2:158671137-158671159 AAGCCTGGCCTGCTCATAACAGG + Intronic
941516425 2:166485972-166485994 TAGCCTGTGCTGCTTCTCAGCGG + Intronic
944408657 2:199414689-199414711 CAGCCTTTCCTGCTTGTCACGGG + Intronic
944442459 2:199756371-199756393 GAGCCTGGCATCCTCCTCTCTGG + Intergenic
946018069 2:216620158-216620180 TAGCTTTGCCTGCTTCTCAGTGG + Intergenic
946228948 2:218279880-218279902 TAGCCTTGTCTGCTTCTCAGAGG - Intronic
948503121 2:238409134-238409156 GAGCATGGCCTGCCTGTCCCTGG + Intergenic
948603728 2:239121748-239121770 GGGCCTGGCCTGCGTCACAGAGG - Intronic
949017601 2:241722212-241722234 GAGGCTGGCAGGCTTCTCTCAGG + Intronic
1169197790 20:3692772-3692794 GATCCTGGCCTCCTTGGCACAGG - Exonic
1169216978 20:3799804-3799826 GAGCCAGGCCAGCTCCTCACAGG + Intronic
1169248948 20:4045820-4045842 AAGCCTGTCCTGCTTATCTCAGG + Intergenic
1169487317 20:6044161-6044183 GAGCCTGGCCTCCTGCTCCCGGG - Intronic
1172803791 20:37597097-37597119 GAGGCTGGCCTGGTGCACACAGG - Intergenic
1172990384 20:39031740-39031762 AAGCCTGCCCTGACTCTCACTGG - Intronic
1173176070 20:40765846-40765868 GAGGCTGGCCTGCTAGTTACAGG + Intergenic
1173843811 20:46175593-46175615 GAACCTGGCCTGCAGCTCTCAGG - Intronic
1173957282 20:47043439-47043461 AAGCCAGTCCTGCTTCTCCCTGG + Intronic
1174067469 20:47875626-47875648 CAGCCTGGGCTGCTTCCCACTGG - Intergenic
1174321838 20:49748129-49748151 GAGCCTGTCCTGGCTCACACAGG - Intergenic
1175204715 20:57302755-57302777 GATCATGGCCTGCTTCACAGAGG - Intergenic
1176167368 20:63681178-63681200 GACCCTGGCCCCCTTCTCATTGG + Intronic
1176234667 20:64048794-64048816 GAGCCCGGCCTCCTGCTCCCGGG - Exonic
1178222906 21:30681270-30681292 GAACCTCCCCTGCTTCTCTCAGG - Intergenic
1178475342 21:32932914-32932936 GAGACTGGGCTTCTTTTCACAGG - Intergenic
1178788626 21:35677346-35677368 GGCCCTGACCTGCTTCTCTCAGG - Intronic
1179101643 21:38359797-38359819 GGGCCTTGCCTGCCTCTCCCAGG + Intergenic
1179561048 21:42216485-42216507 GGGCCTGGCCTGGTTCACATGGG - Intronic
1179609728 21:42542353-42542375 GTCCCGGGCCTGCTTCCCACAGG + Intronic
1180187072 21:46145332-46145354 GAGGCTGACCCGCTTCTCACTGG + Intronic
1180732654 22:17993701-17993723 ATTCCTGGCCTGCTTCTCAGGGG - Intronic
1181169018 22:20997963-20997985 GGGCCAGGCCTGGTTTTCACAGG + Exonic
1181308775 22:21932362-21932384 GAGGCTTGCCTGCTTTTCACTGG + Intronic
1181474809 22:23161546-23161568 CAGCCTGGGCTGCTGCTAACTGG + Exonic
1182087845 22:27573772-27573794 GAGCCAGGCCTGCTTCTCTGGGG - Intergenic
1183507709 22:38218805-38218827 GGGCCTGGCTTGCTGCTGACGGG - Intergenic
1183704037 22:39466065-39466087 GGGCCTGGCTGGCTTCTGACTGG - Intronic
1185254846 22:49826592-49826614 GCGCGTGGCCGGCTTCTCCCTGG - Intronic
1185402697 22:50627019-50627041 GAACCTGACCTGCTTCCCGCCGG - Exonic
949373715 3:3363830-3363852 GACCCTGTCCTGCTTATCTCGGG - Intergenic
950275254 3:11655417-11655439 CAGCCTGGCTTCCTTCCCACAGG + Intronic
950591083 3:13935998-13936020 CAGCCTGCCCTCCTTCTCAAGGG - Intergenic
950886383 3:16366380-16366402 GAAACTGGCCTTCATCTCACTGG + Intronic
951158875 3:19390768-19390790 GAATCTGGCCTGCATATCACTGG - Intronic
951906022 3:27708281-27708303 GAGTCTGGCCTCCTTCTTGCTGG + Intergenic
953493466 3:43368109-43368131 GAGCCTGGCCTGTCTCCCACAGG + Intronic
954036887 3:47855615-47855637 AAGCCTGGCCTGCAGCTCAGTGG - Intronic
954753483 3:52826686-52826708 GAGCCTGGGCTGGGGCTCACAGG + Intronic
955080209 3:55651151-55651173 GCACCTGGCCTGCCTCTCATAGG + Intronic
956411643 3:68985859-68985881 GAGCCTGACGTGGGTCTCACTGG + Intronic
960056357 3:113279139-113279161 GGGCCTGGCCTGCTCCTGACGGG - Intronic
961366025 3:126399953-126399975 GATCATGGCCTGCTTCTGAGGGG + Intronic
961713267 3:128843012-128843034 AAGCCAGGCCTGCTTCCCACAGG + Intergenic
962935150 3:140073932-140073954 GAGCCGAGTCTGCTTTTCACAGG - Intronic
963674285 3:148288972-148288994 AAACCTGGCCTCCTTCTAACTGG + Intergenic
967494521 3:190127943-190127965 TGGCCTGCCCTGCTTCTGACAGG + Intergenic
968605680 4:1534252-1534274 AAGCCTGGCCTGTGCCTCACCGG - Intergenic
969102019 4:4776498-4776520 GAGCCTCTCCTGCATGTCACAGG + Intergenic
969214120 4:5709123-5709145 GCGGCTGGCCTGTTTCCCACTGG - Intronic
969278523 4:6153285-6153307 GAGCCTGGCCTCCTTCACACAGG + Intronic
969308217 4:6337502-6337524 GAGCCAGGGCGGCCTCTCACAGG + Intronic
972745522 4:41928474-41928496 GAGCCAGGCTTGATTCTCACTGG - Intergenic
973975027 4:56254612-56254634 GACCCTGGCCCACTTCCCACTGG + Intronic
977641543 4:99362942-99362964 CAGCCTTGCCTTATTCTCACAGG + Intergenic
979361372 4:119769518-119769540 GAGCAAGGCCTGCTCCTGACTGG + Intergenic
981027914 4:140095102-140095124 GAGCCCCGCCTCCTTCTCAAAGG + Intronic
981850608 4:149225635-149225657 GAGGCTGGGCAGCTTCTCCCAGG + Intergenic
982233404 4:153230035-153230057 GTGCCTTGCCTTCTTCTCTCAGG - Intronic
983904712 4:173170118-173170140 GACCCTGACCTGCTTCCCCCCGG + Intronic
985617607 5:933235-933257 GGGCCTGACCTGCTGCTCAGGGG - Intergenic
988850055 5:35172108-35172130 GAGCCTGCCTTGAGTCTCACGGG - Intronic
990571376 5:57082432-57082454 GAGCTTGACCAGCTTCTCACAGG - Intergenic
990992635 5:61700644-61700666 TTGCCTGGCCTGCTGCTCATTGG + Intronic
991574936 5:68092894-68092916 GAGCCCGGCCTGCTTCTTGAGGG + Intergenic
992508072 5:77407281-77407303 GACCAGGGCCCGCTTCTCACAGG - Intronic
996508838 5:124296719-124296741 GTGCCTGGCCTTGTTCTCATAGG + Intergenic
997526293 5:134555252-134555274 GGGCCTGTCCTGCCCCTCACTGG + Intronic
999882925 5:155887141-155887163 GAGACTTTCCTGCTTCACACAGG + Intronic
1001853562 5:174990920-174990942 CAGCCTGGCATGCTTCTGCCTGG + Intergenic
1002310179 5:178309388-178309410 CTGCCTGGCCTGCGGCTCACAGG - Intronic
1002427724 5:179185915-179185937 CGGCCTGGCCTCCTTCTCCCTGG - Intronic
1002784656 6:392164-392186 GGGCCGGGCCTGTTTCTCGCAGG - Intronic
1006181182 6:32154269-32154291 GGGCCTGGGCTGCTGCTCACGGG + Exonic
1006665398 6:35689316-35689338 CAGCCTGGCCTGCCCCTCTCCGG - Intronic
1011184921 6:84663438-84663460 GTTCTTGGCTTGCTTCTCACAGG + Intergenic
1012133765 6:95529305-95529327 GAGCATGGCCTCCATCTCAAAGG + Intergenic
1012437344 6:99228086-99228108 GAGCCTAGCCTACGTCTCAGGGG - Intergenic
1013179596 6:107706938-107706960 GAGCCTGGCATGGGTCTCAGTGG - Intronic
1017397742 6:154022411-154022433 GGGCCTGGCCTGCTCCCCACAGG + Intronic
1017978478 6:159377820-159377842 GAGCCTCCCCTGCTTCTCCAGGG - Intergenic
1018818876 6:167357666-167357688 CAGCCTGGCCTGCTCCCCTCTGG - Intronic
1018901154 6:168052412-168052434 GAGCCTGGCCCGCACCCCACAGG + Intergenic
1019605336 7:1907249-1907271 GACCCAGGCCAGCTCCTCACTGG - Intronic
1019776599 7:2915270-2915292 GAGCCTGGCCCGGTCCTCGCTGG - Exonic
1019998936 7:4743760-4743782 CTGCCTGGCCTGCTTCTCTCTGG - Intronic
1021668652 7:23013590-23013612 GAGGCTGGACTGCTCCTCGCCGG + Intronic
1022104125 7:27186133-27186155 GGGGCTGCCCTGCTGCTCACCGG + Intergenic
1023033211 7:36108936-36108958 GAGACTGGACTGCTTCTCCAGGG - Intergenic
1024235096 7:47391841-47391863 GAGACTGGGCTGAGTCTCACTGG - Intronic
1024757308 7:52550020-52550042 GAGCCTGGCCTCCTCCGCATGGG + Intergenic
1026138289 7:67682841-67682863 GAGCCTGGCTGTCTTCTCTCAGG + Intergenic
1029600240 7:101559058-101559080 GAGGCTGGTCTGCATCTTACCGG + Intergenic
1029724932 7:102396535-102396557 GAGCCTGGGCCTCGTCTCACCGG - Exonic
1031363224 7:120871804-120871826 GACCCTGGCTTGCTTCTTGCAGG - Intergenic
1032082771 7:128868394-128868416 CACCCTAGCCTGCTTGTCACAGG - Intronic
1032854601 7:135823975-135823997 GAGCTGGGCCTCCTTCTCTCAGG - Intergenic
1034195128 7:149240293-149240315 CAGCCTGGGCTGCTTCTCCTTGG + Intronic
1034880160 7:154757034-154757056 GAGGCTGGCCTGTTCCTCAGGGG - Intronic
1035057215 7:156043673-156043695 GAACCTGGCCTCCTGCTCCCTGG + Intergenic
1036227342 8:6970892-6970914 GAGCCTGGCCTGCATATCACAGG + Intergenic
1036229796 8:6990051-6990073 GAGCCTGGCCTGCATATCACAGG + Intergenic
1036232247 8:7009154-7009176 GAGCCTGGCCTGCATATCACAGG + Intronic
1037902338 8:22695212-22695234 CAGCCTGCCCTGATTCTGACCGG - Intergenic
1039379931 8:37075783-37075805 GAGCGGGGCCTGCTTCACAAAGG - Intergenic
1047740253 8:127800948-127800970 GAGCCTGCCCTGACTCTGACCGG - Intergenic
1049276676 8:141723525-141723547 ACCCCTGGCCTGCTTCTCTCTGG - Intergenic
1049310810 8:141932866-141932888 CAGCCTGGGCTGCCTCGCACAGG + Intergenic
1049387615 8:142352104-142352126 AGGCCGGGCCGGCTTCTCACTGG - Intronic
1049583819 8:143424009-143424031 GAGCCTGGCCTTCTCCCCAGGGG - Intronic
1049698823 8:143997361-143997383 CAGTCTGGCCAGCTTTTCACTGG + Intronic
1050965533 9:11796791-11796813 ATGCCTGGCCTTCTTCTAACTGG - Intergenic
1055073146 9:72188273-72188295 GAGGCTGCCCTGCTCATCACAGG + Intronic
1056831739 9:89922979-89923001 GAGCCTGGAAGGCTTCTCCCAGG + Intergenic
1058506579 9:105672551-105672573 ATGCCTGGCCTGCTTTTCTCTGG + Intergenic
1059298172 9:113291071-113291093 AAGCCTGGCCTGCATTCCACGGG - Intronic
1060547925 9:124471504-124471526 GAGCCTGGCCTGGGGCTCAGAGG - Intronic
1060818500 9:126648383-126648405 GAGCCTGGCCTGGTTCTCCCAGG - Intronic
1061213461 9:129206647-129206669 GTCCCAGGCCTGCATCTCACTGG - Intergenic
1061296052 9:129677434-129677456 GAGCCTAGGCTGCTTCTAGCAGG - Intronic
1061367212 9:130178312-130178334 GAGCCCAGCCTCCTCCTCACAGG + Intronic
1062231262 9:135482939-135482961 GAGCCTGGCCACCTACACACAGG - Intronic
1189030717 X:37446880-37446902 GAGACTGGACTAGTTCTCACAGG - Intronic
1192734237 X:73833282-73833304 GAGCTTGGCCAGATTCTCAAAGG + Intergenic
1194493358 X:94578350-94578372 GAGCCTGGCTGGCTTCTCACCGG + Intergenic
1199106614 X:143875993-143876015 GACGGTGGCCTTCTTCTCACAGG - Intergenic
1200061447 X:153485587-153485609 GGGCCTGGCCTGACTCACACAGG + Intronic