ID: 1132359659

View in Genome Browser
Species Human (GRCh38)
Location 15:101201812-101201834
Sequence CACAGTTCAGGAAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 304}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132359659_1132359668 30 Left 1132359659 15:101201812-101201834 CCTTCCACCTTTCCTGAACTGTG 0: 1
1: 0
2: 4
3: 22
4: 304
Right 1132359668 15:101201865-101201887 TCTCCCAGTAGGTGTCCAGGAGG 0: 1
1: 0
2: 3
3: 10
4: 161
1132359659_1132359665 19 Left 1132359659 15:101201812-101201834 CCTTCCACCTTTCCTGAACTGTG 0: 1
1: 0
2: 4
3: 22
4: 304
Right 1132359665 15:101201854-101201876 TGCCTTCATGTTCTCCCAGTAGG 0: 1
1: 0
2: 1
3: 18
4: 170
1132359659_1132359667 27 Left 1132359659 15:101201812-101201834 CCTTCCACCTTTCCTGAACTGTG 0: 1
1: 0
2: 4
3: 22
4: 304
Right 1132359667 15:101201862-101201884 TGTTCTCCCAGTAGGTGTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 128
1132359659_1132359663 -8 Left 1132359659 15:101201812-101201834 CCTTCCACCTTTCCTGAACTGTG 0: 1
1: 0
2: 4
3: 22
4: 304
Right 1132359663 15:101201827-101201849 GAACTGTGTTCAAAGAGAACTGG 0: 1
1: 0
2: 1
3: 18
4: 191
1132359659_1132359664 -5 Left 1132359659 15:101201812-101201834 CCTTCCACCTTTCCTGAACTGTG 0: 1
1: 0
2: 4
3: 22
4: 304
Right 1132359664 15:101201830-101201852 CTGTGTTCAAAGAGAACTGGAGG 0: 1
1: 0
2: 1
3: 19
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132359659 Original CRISPR CACAGTTCAGGAAAGGTGGA AGG (reversed) Intronic