ID: 1132359661

View in Genome Browser
Species Human (GRCh38)
Location 15:101201819-101201841
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 194}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132359661_1132359672 26 Left 1132359661 15:101201819-101201841 CCTTTCCTGAACTGTGTTCAAAG 0: 1
1: 0
2: 3
3: 10
4: 194
Right 1132359672 15:101201868-101201890 CCCAGTAGGTGTCCAGGAGGGGG 0: 1
1: 0
2: 4
3: 50
4: 509
1132359661_1132359665 12 Left 1132359661 15:101201819-101201841 CCTTTCCTGAACTGTGTTCAAAG 0: 1
1: 0
2: 3
3: 10
4: 194
Right 1132359665 15:101201854-101201876 TGCCTTCATGTTCTCCCAGTAGG 0: 1
1: 0
2: 1
3: 18
4: 170
1132359661_1132359670 25 Left 1132359661 15:101201819-101201841 CCTTTCCTGAACTGTGTTCAAAG 0: 1
1: 0
2: 3
3: 10
4: 194
Right 1132359670 15:101201867-101201889 TCCCAGTAGGTGTCCAGGAGGGG 0: 1
1: 0
2: 1
3: 10
4: 179
1132359661_1132359667 20 Left 1132359661 15:101201819-101201841 CCTTTCCTGAACTGTGTTCAAAG 0: 1
1: 0
2: 3
3: 10
4: 194
Right 1132359667 15:101201862-101201884 TGTTCTCCCAGTAGGTGTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 128
1132359661_1132359668 23 Left 1132359661 15:101201819-101201841 CCTTTCCTGAACTGTGTTCAAAG 0: 1
1: 0
2: 3
3: 10
4: 194
Right 1132359668 15:101201865-101201887 TCTCCCAGTAGGTGTCCAGGAGG 0: 1
1: 0
2: 3
3: 10
4: 161
1132359661_1132359669 24 Left 1132359661 15:101201819-101201841 CCTTTCCTGAACTGTGTTCAAAG 0: 1
1: 0
2: 3
3: 10
4: 194
Right 1132359669 15:101201866-101201888 CTCCCAGTAGGTGTCCAGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132359661 Original CRISPR CTTTGAACACAGTTCAGGAA AGG (reversed) Intronic