ID: 1132359662

View in Genome Browser
Species Human (GRCh38)
Location 15:101201824-101201846
Sequence GTTCTCTTTGAACACAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 167}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132359662_1132359669 19 Left 1132359662 15:101201824-101201846 CCTGAACTGTGTTCAAAGAGAAC 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1132359669 15:101201866-101201888 CTCCCAGTAGGTGTCCAGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 173
1132359662_1132359670 20 Left 1132359662 15:101201824-101201846 CCTGAACTGTGTTCAAAGAGAAC 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1132359670 15:101201867-101201889 TCCCAGTAGGTGTCCAGGAGGGG 0: 1
1: 0
2: 1
3: 10
4: 179
1132359662_1132359672 21 Left 1132359662 15:101201824-101201846 CCTGAACTGTGTTCAAAGAGAAC 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1132359672 15:101201868-101201890 CCCAGTAGGTGTCCAGGAGGGGG 0: 1
1: 0
2: 4
3: 50
4: 509
1132359662_1132359667 15 Left 1132359662 15:101201824-101201846 CCTGAACTGTGTTCAAAGAGAAC 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1132359667 15:101201862-101201884 TGTTCTCCCAGTAGGTGTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 128
1132359662_1132359665 7 Left 1132359662 15:101201824-101201846 CCTGAACTGTGTTCAAAGAGAAC 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1132359665 15:101201854-101201876 TGCCTTCATGTTCTCCCAGTAGG 0: 1
1: 0
2: 1
3: 18
4: 170
1132359662_1132359668 18 Left 1132359662 15:101201824-101201846 CCTGAACTGTGTTCAAAGAGAAC 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1132359668 15:101201865-101201887 TCTCCCAGTAGGTGTCCAGGAGG 0: 1
1: 0
2: 3
3: 10
4: 161
1132359662_1132359674 29 Left 1132359662 15:101201824-101201846 CCTGAACTGTGTTCAAAGAGAAC 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1132359674 15:101201876-101201898 GTGTCCAGGAGGGGGTTAGAAGG 0: 1
1: 0
2: 1
3: 12
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132359662 Original CRISPR GTTCTCTTTGAACACAGTTC AGG (reversed) Intronic