ID: 1132359665

View in Genome Browser
Species Human (GRCh38)
Location 15:101201854-101201876
Sequence TGCCTTCATGTTCTCCCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132359659_1132359665 19 Left 1132359659 15:101201812-101201834 CCTTCCACCTTTCCTGAACTGTG 0: 1
1: 0
2: 4
3: 22
4: 304
Right 1132359665 15:101201854-101201876 TGCCTTCATGTTCTCCCAGTAGG 0: 1
1: 0
2: 1
3: 18
4: 170
1132359660_1132359665 15 Left 1132359660 15:101201816-101201838 CCACCTTTCCTGAACTGTGTTCA 0: 1
1: 0
2: 3
3: 20
4: 254
Right 1132359665 15:101201854-101201876 TGCCTTCATGTTCTCCCAGTAGG 0: 1
1: 0
2: 1
3: 18
4: 170
1132359662_1132359665 7 Left 1132359662 15:101201824-101201846 CCTGAACTGTGTTCAAAGAGAAC 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1132359665 15:101201854-101201876 TGCCTTCATGTTCTCCCAGTAGG 0: 1
1: 0
2: 1
3: 18
4: 170
1132359661_1132359665 12 Left 1132359661 15:101201819-101201841 CCTTTCCTGAACTGTGTTCAAAG 0: 1
1: 0
2: 3
3: 10
4: 194
Right 1132359665 15:101201854-101201876 TGCCTTCATGTTCTCCCAGTAGG 0: 1
1: 0
2: 1
3: 18
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132359665 Original CRISPR TGCCTTCATGTTCTCCCAGT AGG Intronic